ID: 1076846657

View in Genome Browser
Species Human (GRCh38)
Location 10:133072489-133072511
Sequence TCCGGCTGGAGGGCGGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076846645_1076846657 14 Left 1076846645 10:133072452-133072474 CCACGGATGCTGACGGACCTGCA No data
Right 1076846657 10:133072489-133072511 TCCGGCTGGAGGGCGGGTCTGGG No data
1076846648_1076846657 -3 Left 1076846648 10:133072469-133072491 CCTGCACTCACCACAGGAGGTCC No data
Right 1076846657 10:133072489-133072511 TCCGGCTGGAGGGCGGGTCTGGG No data
1076846643_1076846657 24 Left 1076846643 10:133072442-133072464 CCTGCAGCTGCCACGGATGCTGA No data
Right 1076846657 10:133072489-133072511 TCCGGCTGGAGGGCGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076846657 Original CRISPR TCCGGCTGGAGGGCGGGTCT GGG Intronic