ID: 1076847917

View in Genome Browser
Species Human (GRCh38)
Location 10:133078807-133078829
Sequence GGCAGTTTCTCACACACCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076847917_1076847924 14 Left 1076847917 10:133078807-133078829 CCCGCGGTGTGTGAGAAACTGCC No data
Right 1076847924 10:133078844-133078866 TGAGAAACTGCCCCGCGGCGTGG No data
1076847917_1076847925 15 Left 1076847917 10:133078807-133078829 CCCGCGGTGTGTGAGAAACTGCC No data
Right 1076847925 10:133078845-133078867 GAGAAACTGCCCCGCGGCGTGGG No data
1076847917_1076847923 9 Left 1076847917 10:133078807-133078829 CCCGCGGTGTGTGAGAAACTGCC No data
Right 1076847923 10:133078839-133078861 GCGTGTGAGAAACTGCCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076847917 Original CRISPR GGCAGTTTCTCACACACCGC GGG (reversed) Intronic