ID: 1076847918

View in Genome Browser
Species Human (GRCh38)
Location 10:133078808-133078830
Sequence GGGCAGTTTCTCACACACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076847918_1076847925 14 Left 1076847918 10:133078808-133078830 CCGCGGTGTGTGAGAAACTGCCC No data
Right 1076847925 10:133078845-133078867 GAGAAACTGCCCCGCGGCGTGGG No data
1076847918_1076847923 8 Left 1076847918 10:133078808-133078830 CCGCGGTGTGTGAGAAACTGCCC No data
Right 1076847923 10:133078839-133078861 GCGTGTGAGAAACTGCCCCGCGG No data
1076847918_1076847924 13 Left 1076847918 10:133078808-133078830 CCGCGGTGTGTGAGAAACTGCCC No data
Right 1076847924 10:133078844-133078866 TGAGAAACTGCCCCGCGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076847918 Original CRISPR GGGCAGTTTCTCACACACCG CGG (reversed) Intronic