ID: 1076847920 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:133078828-133078850 |
Sequence | TTTCTCACACGCACGCCGCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1076847920_1076847929 | 14 | Left | 1076847920 | 10:133078828-133078850 | CCCCGCGGCGTGCGTGTGAGAAA | No data | ||
Right | 1076847929 | 10:133078865-133078887 | GGGTGTGAGAAACTGCCCCGCGG | No data | ||||
1076847920_1076847925 | -6 | Left | 1076847920 | 10:133078828-133078850 | CCCCGCGGCGTGCGTGTGAGAAA | No data | ||
Right | 1076847925 | 10:133078845-133078867 | GAGAAACTGCCCCGCGGCGTGGG | No data | ||||
1076847920_1076847924 | -7 | Left | 1076847920 | 10:133078828-133078850 | CCCCGCGGCGTGCGTGTGAGAAA | No data | ||
Right | 1076847924 | 10:133078844-133078866 | TGAGAAACTGCCCCGCGGCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1076847920 | Original CRISPR | TTTCTCACACGCACGCCGCG GGG (reversed) | Intronic | ||