ID: 1076847920

View in Genome Browser
Species Human (GRCh38)
Location 10:133078828-133078850
Sequence TTTCTCACACGCACGCCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076847920_1076847929 14 Left 1076847920 10:133078828-133078850 CCCCGCGGCGTGCGTGTGAGAAA No data
Right 1076847929 10:133078865-133078887 GGGTGTGAGAAACTGCCCCGCGG No data
1076847920_1076847925 -6 Left 1076847920 10:133078828-133078850 CCCCGCGGCGTGCGTGTGAGAAA No data
Right 1076847925 10:133078845-133078867 GAGAAACTGCCCCGCGGCGTGGG No data
1076847920_1076847924 -7 Left 1076847920 10:133078828-133078850 CCCCGCGGCGTGCGTGTGAGAAA No data
Right 1076847924 10:133078844-133078866 TGAGAAACTGCCCCGCGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076847920 Original CRISPR TTTCTCACACGCACGCCGCG GGG (reversed) Intronic