ID: 1076847921

View in Genome Browser
Species Human (GRCh38)
Location 10:133078829-133078851
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076847921_1076847929 13 Left 1076847921 10:133078829-133078851 CCCGCGGCGTGCGTGTGAGAAAC No data
Right 1076847929 10:133078865-133078887 GGGTGTGAGAAACTGCCCCGCGG No data
1076847921_1076847925 -7 Left 1076847921 10:133078829-133078851 CCCGCGGCGTGCGTGTGAGAAAC No data
Right 1076847925 10:133078845-133078867 GAGAAACTGCCCCGCGGCGTGGG No data
1076847921_1076847924 -8 Left 1076847921 10:133078829-133078851 CCCGCGGCGTGCGTGTGAGAAAC No data
Right 1076847924 10:133078844-133078866 TGAGAAACTGCCCCGCGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076847921 Original CRISPR GTTTCTCACACGCACGCCGC GGG (reversed) Intronic