ID: 1076847924

View in Genome Browser
Species Human (GRCh38)
Location 10:133078844-133078866
Sequence TGAGAAACTGCCCCGCGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076847920_1076847924 -7 Left 1076847920 10:133078828-133078850 CCCCGCGGCGTGCGTGTGAGAAA No data
Right 1076847924 10:133078844-133078866 TGAGAAACTGCCCCGCGGCGTGG No data
1076847918_1076847924 13 Left 1076847918 10:133078808-133078830 CCGCGGTGTGTGAGAAACTGCCC No data
Right 1076847924 10:133078844-133078866 TGAGAAACTGCCCCGCGGCGTGG No data
1076847917_1076847924 14 Left 1076847917 10:133078807-133078829 CCCGCGGTGTGTGAGAAACTGCC No data
Right 1076847924 10:133078844-133078866 TGAGAAACTGCCCCGCGGCGTGG No data
1076847922_1076847924 -9 Left 1076847922 10:133078830-133078852 CCGCGGCGTGCGTGTGAGAAACT No data
Right 1076847924 10:133078844-133078866 TGAGAAACTGCCCCGCGGCGTGG No data
1076847921_1076847924 -8 Left 1076847921 10:133078829-133078851 CCCGCGGCGTGCGTGTGAGAAAC 0: 4
1: 21
2: 12
3: 14
4: 22
Right 1076847924 10:133078844-133078866 TGAGAAACTGCCCCGCGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076847924 Original CRISPR TGAGAAACTGCCCCGCGGCG TGG Intronic