ID: 1076847929 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:133078865-133078887 |
| Sequence | GGGTGTGAGAAACTGCCCCG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1076847921_1076847929 | 13 | Left | 1076847921 | 10:133078829-133078851 | CCCGCGGCGTGCGTGTGAGAAAC | No data | ||
| Right | 1076847929 | 10:133078865-133078887 | GGGTGTGAGAAACTGCCCCGCGG | No data | ||||
| 1076847922_1076847929 | 12 | Left | 1076847922 | 10:133078830-133078852 | CCGCGGCGTGCGTGTGAGAAACT | No data | ||
| Right | 1076847929 | 10:133078865-133078887 | GGGTGTGAGAAACTGCCCCGCGG | No data | ||||
| 1076847920_1076847929 | 14 | Left | 1076847920 | 10:133078828-133078850 | CCCCGCGGCGTGCGTGTGAGAAA | No data | ||
| Right | 1076847929 | 10:133078865-133078887 | GGGTGTGAGAAACTGCCCCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1076847929 | Original CRISPR | GGGTGTGAGAAACTGCCCCG CGG | Intronic | ||