ID: 1076847929

View in Genome Browser
Species Human (GRCh38)
Location 10:133078865-133078887
Sequence GGGTGTGAGAAACTGCCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076847921_1076847929 13 Left 1076847921 10:133078829-133078851 CCCGCGGCGTGCGTGTGAGAAAC No data
Right 1076847929 10:133078865-133078887 GGGTGTGAGAAACTGCCCCGCGG No data
1076847922_1076847929 12 Left 1076847922 10:133078830-133078852 CCGCGGCGTGCGTGTGAGAAACT No data
Right 1076847929 10:133078865-133078887 GGGTGTGAGAAACTGCCCCGCGG No data
1076847920_1076847929 14 Left 1076847920 10:133078828-133078850 CCCCGCGGCGTGCGTGTGAGAAA No data
Right 1076847929 10:133078865-133078887 GGGTGTGAGAAACTGCCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076847929 Original CRISPR GGGTGTGAGAAACTGCCCCG CGG Intronic