ID: 1076849446

View in Genome Browser
Species Human (GRCh38)
Location 10:133085968-133085990
Sequence TCCACACCTAGTGATAACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076849446_1076849466 27 Left 1076849446 10:133085968-133085990 CCTAGGTTATCACTAGGTGTGGA No data
Right 1076849466 10:133086018-133086040 GTCCTGACCACCACGTGCGGGGG No data
1076849446_1076849455 -9 Left 1076849446 10:133085968-133085990 CCTAGGTTATCACTAGGTGTGGA No data
Right 1076849455 10:133085982-133086004 AGGTGTGGAATGGGGGGGGAGGG No data
1076849446_1076849457 4 Left 1076849446 10:133085968-133085990 CCTAGGTTATCACTAGGTGTGGA No data
Right 1076849457 10:133085995-133086017 GGGGGGAGGGGCAGCCCTCCCGG No data
1076849446_1076849464 25 Left 1076849446 10:133085968-133085990 CCTAGGTTATCACTAGGTGTGGA No data
Right 1076849464 10:133086016-133086038 GGGTCCTGACCACCACGTGCGGG No data
1076849446_1076849458 5 Left 1076849446 10:133085968-133085990 CCTAGGTTATCACTAGGTGTGGA No data
Right 1076849458 10:133085996-133086018 GGGGGAGGGGCAGCCCTCCCGGG No data
1076849446_1076849454 -10 Left 1076849446 10:133085968-133085990 CCTAGGTTATCACTAGGTGTGGA No data
Right 1076849454 10:133085981-133086003 TAGGTGTGGAATGGGGGGGGAGG No data
1076849446_1076849463 24 Left 1076849446 10:133085968-133085990 CCTAGGTTATCACTAGGTGTGGA No data
Right 1076849463 10:133086015-133086037 CGGGTCCTGACCACCACGTGCGG No data
1076849446_1076849456 -8 Left 1076849446 10:133085968-133085990 CCTAGGTTATCACTAGGTGTGGA No data
Right 1076849456 10:133085983-133086005 GGTGTGGAATGGGGGGGGAGGGG No data
1076849446_1076849465 26 Left 1076849446 10:133085968-133085990 CCTAGGTTATCACTAGGTGTGGA No data
Right 1076849465 10:133086017-133086039 GGTCCTGACCACCACGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076849446 Original CRISPR TCCACACCTAGTGATAACCT AGG (reversed) Intronic