ID: 1076849465

View in Genome Browser
Species Human (GRCh38)
Location 10:133086017-133086039
Sequence GGTCCTGACCACCACGTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076849446_1076849465 26 Left 1076849446 10:133085968-133085990 CCTAGGTTATCACTAGGTGTGGA No data
Right 1076849465 10:133086017-133086039 GGTCCTGACCACCACGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076849465 Original CRISPR GGTCCTGACCACCACGTGCG GGG Intronic