ID: 1076850938

View in Genome Browser
Species Human (GRCh38)
Location 10:133092678-133092700
Sequence TTTCTCTTTCTTGTTTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6590
Summary {0: 1, 1: 0, 2: 57, 3: 651, 4: 5881}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076850938_1076850940 -9 Left 1076850938 10:133092678-133092700 CCAGAAAAAACAAGAAAGAGAAA 0: 1
1: 0
2: 57
3: 651
4: 5881
Right 1076850940 10:133092692-133092714 AAAGAGAAACAGGAAGAACCAGG No data
1076850938_1076850945 24 Left 1076850938 10:133092678-133092700 CCAGAAAAAACAAGAAAGAGAAA 0: 1
1: 0
2: 57
3: 651
4: 5881
Right 1076850945 10:133092725-133092747 TGAATGAAGAAGGAGAAATAGGG No data
1076850938_1076850942 14 Left 1076850938 10:133092678-133092700 CCAGAAAAAACAAGAAAGAGAAA 0: 1
1: 0
2: 57
3: 651
4: 5881
Right 1076850942 10:133092715-133092737 AAGAAGCACCTGAATGAAGAAGG No data
1076850938_1076850947 28 Left 1076850938 10:133092678-133092700 CCAGAAAAAACAAGAAAGAGAAA 0: 1
1: 0
2: 57
3: 651
4: 5881
Right 1076850947 10:133092729-133092751 TGAAGAAGGAGAAATAGGGAGGG No data
1076850938_1076850946 27 Left 1076850938 10:133092678-133092700 CCAGAAAAAACAAGAAAGAGAAA 0: 1
1: 0
2: 57
3: 651
4: 5881
Right 1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG No data
1076850938_1076850944 23 Left 1076850938 10:133092678-133092700 CCAGAAAAAACAAGAAAGAGAAA 0: 1
1: 0
2: 57
3: 651
4: 5881
Right 1076850944 10:133092724-133092746 CTGAATGAAGAAGGAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076850938 Original CRISPR TTTCTCTTTCTTGTTTTTTC TGG (reversed) Intronic
Too many off-targets to display for this crispr