ID: 1076850941

View in Genome Browser
Species Human (GRCh38)
Location 10:133092710-133092732
Sequence TTCATTCAGGTGCTTCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 214}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076850941_1076850947 -4 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850947 10:133092729-133092751 TGAAGAAGGAGAAATAGGGAGGG No data
1076850941_1076850952 15 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850952 10:133092748-133092770 AGGGAGGAAGGAAGGAAGGAAGG 0: 1151
1: 38827
2: 32260
3: 41393
4: 57649
1076850941_1076850953 19 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850953 10:133092752-133092774 AGGAAGGAAGGAAGGAAGGAAGG 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
1076850941_1076850955 27 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850955 10:133092760-133092782 AGGAAGGAAGGAAGGAAGGAAGG 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
1076850941_1076850949 3 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850949 10:133092736-133092758 GGAGAAATAGGGAGGGAGGAAGG No data
1076850941_1076850954 23 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850954 10:133092756-133092778 AGGAAGGAAGGAAGGAAGGAAGG 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
1076850941_1076850951 11 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850951 10:133092744-133092766 AGGGAGGGAGGAAGGAAGGAAGG 0: 1203
1: 4496
2: 45150
3: 45113
4: 57046
1076850941_1076850950 7 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850950 10:133092740-133092762 AAATAGGGAGGGAGGAAGGAAGG No data
1076850941_1076850944 -9 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850944 10:133092724-133092746 CTGAATGAAGAAGGAGAAATAGG No data
1076850941_1076850946 -5 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG No data
1076850941_1076850948 -1 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850948 10:133092732-133092754 AGAAGGAGAAATAGGGAGGGAGG No data
1076850941_1076850945 -8 Left 1076850941 10:133092710-133092732 CCAGGAAGAAGCACCTGAATGAA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1076850945 10:133092725-133092747 TGAATGAAGAAGGAGAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076850941 Original CRISPR TTCATTCAGGTGCTTCTTCC TGG (reversed) Intronic
900938406 1:5781519-5781541 ATCACTCAGCTGCTTCCTCCTGG - Intergenic
901896429 1:12316895-12316917 TGCAGTCAGGGGCTTCATCCAGG - Intronic
902064334 1:13671779-13671801 TTCATTGAGTTACTTCTTCATGG + Intergenic
903447849 1:23433638-23433660 CTCCTTGTGGTGCTTCTTCCTGG + Exonic
903737346 1:25538512-25538534 CCCATGCAGCTGCTTCTTCCAGG - Intergenic
906220020 1:44071232-44071254 TTCCTCAAGGTTCTTCTTCCTGG + Intergenic
906899456 1:49817876-49817898 ATCATTCACATGCTTTTTCCGGG + Intronic
907295898 1:53453977-53453999 TTCCTTGAGGTGGTTGTTCCAGG - Intergenic
907453196 1:54560333-54560355 TACATACAGGTGCCTCTGCCTGG - Intronic
907559931 1:55379005-55379027 TTCATCCTGGAGCATCTTCCTGG + Intergenic
909043476 1:70682102-70682124 TTCATTTATGTCCTTTTTCCTGG + Intergenic
909644400 1:77900205-77900227 TTCATTCTGGTTCTTTTTCCTGG + Intronic
911417582 1:97594594-97594616 TTCATTCAGGTGGTTCTTCTTGG + Intronic
916406785 1:164505940-164505962 AGCATTCCTGTGCTTCTTCCTGG + Intergenic
918294654 1:183144934-183144956 TTCACTCTGCTGCTTCTCCCAGG + Exonic
920016430 1:202913695-202913717 TTCAATTTGTTGCTTCTTCCGGG - Intronic
921799632 1:219387182-219387204 TTCATTCAGCTGCTCCTGCCTGG + Intergenic
922067677 1:222159589-222159611 TTGACTCAGCTCCTTCTTCCTGG + Intergenic
922506654 1:226130032-226130054 TTGGGTTAGGTGCTTCTTCCTGG + Intergenic
923286584 1:232501916-232501938 TTCCTTCGGCTGCTTCTCCCTGG + Intronic
923306327 1:232692151-232692173 CTCATTCAAGTGATACTTCCTGG + Intergenic
923441187 1:234022113-234022135 TTAATACAGGGTCTTCTTCCTGG + Intronic
923535663 1:234849543-234849565 TTCATCCATGTGGTTCATCCAGG - Intergenic
924598469 1:245467311-245467333 CCCATTCAGATGCTTCTTCATGG + Intronic
924952663 1:248898585-248898607 TTCCTTCAGGAGCTCCTGCCAGG - Intergenic
1063755958 10:9008719-9008741 TTCATGTAGGTTCTTCTTACTGG - Intergenic
1063818944 10:9812172-9812194 TTTATTCTGGTGCTTTTTCAAGG + Intergenic
1064158492 10:12923404-12923426 TTTATTCTGCTGCTTCCTCCTGG + Intronic
1064226140 10:13487048-13487070 TTCCTTCATGTGCTCCTTCAAGG + Intronic
1066048224 10:31612805-31612827 TTCATTCAGGGCTTTCTCCCAGG - Intergenic
1069161140 10:65093742-65093764 TTTTCTCAGGTGCTGCTTCCAGG + Intergenic
1069445748 10:68471847-68471869 TTCGTTCAGCTGCTCCATCCTGG + Exonic
1069836462 10:71311618-71311640 TTCCTGCATTTGCTTCTTCCTGG - Intergenic
1070176804 10:73977804-73977826 TTCATTTATTTGCTTCATCCTGG + Intergenic
1071465756 10:85938199-85938221 TTAATTCAGGTGGATTTTCCTGG - Intronic
1072546121 10:96440867-96440889 TGCATTAAGATCCTTCTTCCAGG - Intronic
1074261032 10:111853415-111853437 TTCATTCTGGTCCATTTTCCTGG + Intergenic
1075470646 10:122686836-122686858 TCCATTTACCTGCTTCTTCCAGG + Intergenic
1076324057 10:129607266-129607288 TTCTTCCAGGTAATTCTTCCCGG - Intronic
1076850941 10:133092710-133092732 TTCATTCAGGTGCTTCTTCCTGG - Intronic
1077151659 11:1075552-1075574 TGCTTCCAGGTGCTTCTTCAGGG + Intergenic
1077368050 11:2169196-2169218 GTCATTTGGGAGCTTCTTCCGGG + Intronic
1079366664 11:19815920-19815942 ATCAATCAGGGCCTTCTTCCAGG + Intronic
1080384242 11:31801292-31801314 TTCATTCAAGTGCCTTTCCCTGG + Intronic
1081203434 11:40246459-40246481 TTCATTTAGATGCTTCTTTGAGG + Intronic
1084195397 11:67521675-67521697 TTCATTCAGCTGACACTTCCTGG - Intronic
1084398773 11:68931736-68931758 CTTATTCAGTGGCTTCTTCCAGG + Intronic
1087315293 11:96595419-96595441 CTCATTCAGATGCATCTTTCAGG - Intergenic
1089609060 11:119659438-119659460 CTCAGACAGGTGCTGCTTCCAGG + Intronic
1089918704 11:122185941-122185963 TTCTTTCAGGTGGTCATTCCAGG - Intergenic
1090738932 11:129639118-129639140 CTCATACAAGTGCGTCTTCCTGG + Intergenic
1091086972 11:132730554-132730576 ATCACTCAGGTGCTTCTCCAGGG - Intronic
1093162507 12:15765187-15765209 TTCATTTAGGTACTTTTTTCAGG - Intronic
1093215309 12:16355081-16355103 CTCATTCAGCAACTTCTTCCTGG + Intronic
1093229284 12:16523545-16523567 TTCATTCTGGTGATGCTTTCTGG + Intronic
1093367928 12:18326270-18326292 TTCTTACAGCTTCTTCTTCCAGG + Intronic
1093533005 12:20189232-20189254 TTCATTCAAGAGCTCCTTGCAGG - Intergenic
1094466118 12:30755033-30755055 CTCCTTCCGGTGCTCCTTCCCGG + Intergenic
1097325315 12:58270039-58270061 TCCATTCAGATGTCTCTTCCTGG - Intergenic
1097550584 12:61062947-61062969 TTCATTCAGGAGCTCCTTTAGGG - Intergenic
1101502315 12:105315659-105315681 CTCATGCAGGTGCTCCTGCCAGG - Intronic
1102167277 12:110816668-110816690 CTCAAGGAGGTGCTTCTTCCTGG + Intergenic
1102631645 12:114286053-114286075 TTCATGCTGTTCCTTCTTCCAGG - Intergenic
1102820092 12:115901220-115901242 TTTATTAAGGTGGTTCTTTCGGG - Intergenic
1104004329 12:124881518-124881540 TTCCTTCAGGTTCTTCTTATGGG + Intronic
1106372608 13:29150739-29150761 TTCATTCAGGTGCATATGGCTGG + Intronic
1106717630 13:32407657-32407679 TCCATTCATGAGCTTCCTCCAGG + Exonic
1107021349 13:35755667-35755689 TTCATGCAGGTGAAGCTTCCAGG + Intergenic
1107641061 13:42443963-42443985 TTTATTCTGCTGCTTCTTCCTGG - Intergenic
1107949843 13:45452100-45452122 TGTATTCAGGTGCTTCTCCCAGG - Intergenic
1108040020 13:46331245-46331267 TTCAATCTGGTGATTCTTGCTGG - Intergenic
1109810252 13:67504057-67504079 TTCATACAGCTGCCCCTTCCTGG - Intergenic
1111459698 13:88522884-88522906 TTCACTGAAGTGCTTCTTCAAGG + Intergenic
1112609205 13:100939540-100939562 TTGATTCTGGTACTTCTTGCTGG + Intergenic
1117212044 14:53510778-53510800 GTGATTCAGGTGCTTCTATCAGG - Intergenic
1117529609 14:56646810-56646832 TTCCTTCAAGTTCTTTTTCCAGG + Intronic
1117658476 14:57980510-57980532 TTCTTTCTGCTGCTTCTTGCTGG - Intronic
1118503231 14:66383313-66383335 TGCATTCCGGTGTTACTTCCTGG - Intergenic
1125804897 15:42485474-42485496 TTCCTTCATGGGTTTCTTCCAGG + Intronic
1130158620 15:81376084-81376106 TTCATTCAGGTAATTCTCTCTGG + Intergenic
1131172337 15:90187328-90187350 TTCATTCACGTTTTCCTTCCTGG - Intronic
1131760677 15:95619249-95619271 TTCAGACAGGTGTTTCTCCCTGG - Intergenic
1133332024 16:4980778-4980800 TCCATGCTGGTCCTTCTTCCCGG - Intronic
1133611619 16:7438957-7438979 TACATACAGGTGCTTCTCACTGG - Intronic
1133906789 16:10029657-10029679 TTCATGCAGGGGCTTCTTCATGG + Intronic
1134625041 16:15717492-15717514 TCCACTCAAGAGCTTCTTCCAGG + Intronic
1135151208 16:20007765-20007787 TAAATGCATGTGCTTCTTCCAGG - Intergenic
1135863632 16:26080438-26080460 TTCTTTCAGGGGCTGCTTTCAGG - Intronic
1137360075 16:47806267-47806289 TTCATTTCGTTGCTTCTTCATGG + Intergenic
1137735454 16:50720021-50720043 TCCATGCAGGTCCCTCTTCCTGG - Intronic
1139151845 16:64391182-64391204 TTCTTTCAGGTGCTTCTTCAGGG + Intergenic
1146817159 17:35951961-35951983 TTCATTCAGGAGCTCCTGCAAGG + Intergenic
1148321183 17:46754663-46754685 TTGTTTCAGGTGCTTCGTTCAGG - Intronic
1148476841 17:47934204-47934226 GTCTTTCAGCTGCTTCGTCCAGG - Intergenic
1151185677 17:72362229-72362251 TCTATTCAGTTGCTTCTTCATGG - Intergenic
1151886458 17:76925840-76925862 TTTTTTCAGGTGCCCCTTCCAGG + Intronic
1151995514 17:77606318-77606340 TTCATGCAGGTCCTCCTCCCAGG - Intergenic
1154038317 18:10828905-10828927 TTCATGCTGCTGCTTCCTCCAGG + Intronic
1155156524 18:23162441-23162463 TTCATTCAGTTCATTCTTTCGGG + Intronic
1155443058 18:25882336-25882358 CACAGTCAAGTGCTTCTTCCAGG + Intergenic
1156459702 18:37314844-37314866 TTCCTTCAGGGGCTTCTATCAGG - Intronic
1156516978 18:37688376-37688398 TTCATACATTTTCTTCTTCCTGG - Intergenic
1158275170 18:55759018-55759040 TTCATTCATTTGCTTCATTCAGG + Intergenic
1163787080 19:19280194-19280216 CTCCTTCAGCTGCTTCTTCTGGG + Exonic
1164402410 19:27911120-27911142 TTCATGCAGGTGCGAGTTCCTGG - Intergenic
1165791826 19:38497121-38497143 TTCATTCATGGGATGCTTCCTGG + Intronic
1167757155 19:51419930-51419952 TTCCTTCAGAGGCTTCTGCCTGG + Intergenic
928539055 2:32267180-32267202 TTCATTCAAGTACATCTTCTGGG + Intergenic
928679156 2:33681083-33681105 TGCATGCAGGGGCTGCTTCCTGG - Intergenic
929277376 2:40041052-40041074 GTTAATCAGGTGCTTGTTCCTGG - Intergenic
930552263 2:52850988-52851010 TTCCTTCAGGAGCTTTTTCAAGG + Intergenic
931239660 2:60440947-60440969 TTGATTCAGATGATTCCTCCGGG - Intergenic
931263199 2:60638118-60638140 TTCAGTCAGATGCTTCTGCATGG - Intergenic
931484817 2:62680067-62680089 TCCTTTTAGGTTCTTCTTCCTGG - Intronic
932582674 2:73002171-73002193 TTCATTCAGTTGCTTAAACCTGG - Intronic
932657523 2:73623390-73623412 TTCATTCAGGTGCTGGGTTCAGG + Intergenic
933323440 2:80806213-80806235 TTCATTAAGGTCTTTTTTCCTGG - Intergenic
933486049 2:82925404-82925426 TTCATTCAGTTGTTTCTTTCTGG - Intergenic
933766705 2:85714166-85714188 CTCCTCCAGGTGCTTCTTCCAGG - Intergenic
933847665 2:86338281-86338303 TTGATTCAGCTCCTTCTTCTAGG + Intergenic
933881411 2:86673622-86673644 TTGTTTCAGGTTCTCCTTCCAGG - Intronic
935009562 2:99120434-99120456 TTAAGTCAGGTGCATCTTCTAGG - Intronic
936494137 2:113003201-113003223 CTCATTCAGGGGATTATTCCAGG + Intergenic
938125616 2:128669184-128669206 TTCATTCAGCAGCTGTTTCCTGG + Intergenic
939183440 2:138830421-138830443 TTGTTTGAGGTGCTTGTTCCTGG + Intergenic
939387938 2:141525647-141525669 TTCTTTTAATTGCTTCTTCCAGG - Intronic
942468231 2:176231363-176231385 TGCATTCCAGTCCTTCTTCCTGG + Intergenic
945672332 2:212817098-212817120 TGCACTCAGGTTCTGCTTCCTGG + Intergenic
948005666 2:234605636-234605658 CTCTCTCAGGTGCTTCTCCCAGG - Intergenic
948298941 2:236887654-236887676 TTCATTCAAATGCCTCTTCCAGG - Intergenic
1169960452 20:11153371-11153393 TTGATTCAGGTTCTTCTTGAGGG + Intergenic
1170064351 20:12294422-12294444 TTGATTCAGCTTCTTCCTCCTGG - Intergenic
1170274799 20:14573617-14573639 TTTATTCAGGTGTTCCTTCTAGG + Intronic
1173363904 20:42368162-42368184 TTCCTTCAGGGGCTCCTTCTGGG + Intronic
1173390059 20:42623692-42623714 TTCATCCACGTGCTTCTTCTGGG + Intronic
1174088427 20:48027101-48027123 TTCTTGCGGGTGCCTCTTCCTGG + Intergenic
1174619125 20:51860619-51860641 GAAATTCAGGGGCTTCTTCCTGG + Intergenic
1174935444 20:54862870-54862892 TTCATTCAGGTGATTTTTCAAGG + Intergenic
1176144821 20:63560916-63560938 TTCCTCCAGGTGGTTCTTCTCGG - Exonic
1177036993 21:16056629-16056651 TTCTTTCAGCTACTTCTTTCAGG - Intergenic
1177220589 21:18187306-18187328 TTCATTCTGTTCCTTCATCCTGG + Intronic
1178891843 21:36526493-36526515 TTCAACCAGCTGCTTCCTCCTGG + Intronic
1182723326 22:32422354-32422376 TATACTCAGGTGCTTCTTCATGG + Intronic
1185235005 22:49706990-49707012 TTCATTCAGCTCCTATTTCCTGG - Intergenic
953663710 3:44910045-44910067 TTCCTTCAGGTGCTCCTTCAAGG - Intronic
954386351 3:50246099-50246121 TTCCTCCAGGTGCTGCTCCCCGG - Intronic
956141229 3:66148702-66148724 TTCCTTCATTTTCTTCTTCCTGG + Intronic
957629882 3:82705564-82705586 TTCCTTCAGGAGCTTTTGCCAGG + Intergenic
958013923 3:87915344-87915366 GTAATTCAGGGGTTTCTTCCTGG - Intergenic
960417340 3:117400505-117400527 GTCAATCAAGTGGTTCTTCCAGG - Intergenic
961625071 3:128255921-128255943 TCCCTTCAGGTGCCTCTTCTTGG + Intronic
962196040 3:133364611-133364633 TTCCTTCATGTACTCCTTCCAGG - Intronic
962637881 3:137349346-137349368 TTCATTCTGGTGTTTTTTCTTGG + Intergenic
963482159 3:145889880-145889902 TGGATTCAGGTGCCTCTGCCTGG + Intergenic
965356847 3:167685429-167685451 TTGATTCAGCTATTTCTTCCTGG - Intronic
965404444 3:168251741-168251763 TTAATACAGATGCTTTTTCCAGG + Intergenic
966165640 3:177013556-177013578 TTCATGCAGTTGCCTCTTCCTGG - Intergenic
966555375 3:181253563-181253585 TTCATTTAGTTGCTGCATCCAGG + Intergenic
967824442 3:193867429-193867451 TTCATTGAGGGCCTCCTTCCAGG + Intergenic
969123337 4:4926057-4926079 TTCCTTCAGGAGCTTCTTTAAGG - Intergenic
969933566 4:10658501-10658523 TTCATTCAGATGGTTATTTCAGG + Intronic
970581735 4:17479362-17479384 CTCACTCAGGTGCTTAGTCCAGG + Intronic
972959291 4:44432592-44432614 TGCAACCAGTTGCTTCTTCCAGG - Intronic
979287328 4:118940925-118940947 TTCATTCAGCTCCCTCTTTCAGG + Intronic
979501305 4:121443546-121443568 TTTATTCAGGGACTTCTTCCTGG - Intergenic
979561239 4:122104399-122104421 GCCAATCAGGTGCTTCTGCCTGG - Intergenic
980356242 4:131732719-131732741 TTCCTTCTGGCGTTTCTTCCTGG - Intergenic
980410584 4:132413463-132413485 TTCATTCAGGTTCTGCAGCCAGG + Intergenic
980893975 4:138843747-138843769 TTTCTTCAGGTGCATCATCCTGG - Intergenic
981780929 4:148428073-148428095 TTGATTCAGGTGCTGTTTGCAGG - Intronic
981908360 4:149950034-149950056 TACATTCAGGATATTCTTCCAGG - Intergenic
982056437 4:151553979-151554001 TTTATGCAGGAGCTCCTTCCTGG + Intronic
982808577 4:159797835-159797857 TTCATTCAGGTCAATTTTCCTGG - Intergenic
983731557 4:171000235-171000257 TTCACTCAGGTTCTTCTCCCTGG + Intergenic
985180577 4:187257092-187257114 TTCAGTCCAGTGCTTCCTCCTGG + Intergenic
986236523 5:5915648-5915670 TTCCTGCGGGTGCTTCCTCCAGG - Intergenic
988312496 5:29578891-29578913 TTAATACAGATGTTTCTTCCAGG - Intergenic
989545395 5:42666851-42666873 TTGATTCATGTGCTTTTTCTGGG - Intronic
991151130 5:63372027-63372049 TTGATTTAGGTGCTTGTTGCTGG + Intergenic
991395610 5:66202177-66202199 ATCATTCAGATGTTTTTTCCTGG + Intergenic
992243729 5:74796122-74796144 TCTGTTCAGGTTCTTCTTCCAGG + Exonic
994123982 5:96149860-96149882 GTCTTTCAGGAGCTTCTTTCAGG + Intergenic
996009819 5:118469508-118469530 ATCATTCAGCTGCTTTTGCCGGG - Intergenic
997630981 5:135368886-135368908 ATTACTCAGGTGCTTCTTCCTGG - Intronic
999883083 5:155889200-155889222 TTCATTTACTTGTTTCTTCCTGG - Intronic
1000149563 5:158486228-158486250 TACATTGAGGTGCTTTCTCCCGG + Intergenic
1002198921 5:177516156-177516178 TTCCTTCAGCTGCTTCTCCTTGG + Exonic
1003575473 6:7290332-7290354 TTTATTCTGCTGCTTATTCCAGG - Intronic
1008831052 6:55762556-55762578 TACATTCTGGTTCTTCTTCAGGG + Intronic
1010803985 6:80213131-80213153 TTCAATTTGGTGCTTCTTCTTGG + Intronic
1011217274 6:85018345-85018367 CTCATTCAGGTCCTGTTTCCTGG + Intergenic
1011596332 6:89020190-89020212 TTAGGTCATGTGCTTCTTCCTGG - Intergenic
1014021486 6:116595110-116595132 TTAATTGAGCAGCTTCTTCCAGG - Exonic
1014154863 6:118098890-118098912 CCCATTCAGGTGTCTCTTCCTGG + Intronic
1014367344 6:120561368-120561390 TTCTTTCAGGAGCTTCTGCAGGG + Intergenic
1015299192 6:131633471-131633493 CCCTTTCAGATGCTTCTTCCTGG - Intronic
1016050673 6:139526838-139526860 TCCATTGAGGAACTTCTTCCTGG - Intergenic
1016267072 6:142245082-142245104 CTCCTTCAGGTGCCTCTTCTAGG + Intergenic
1016714828 6:147212775-147212797 TTCATTCACATGCTCTTTCCTGG - Intronic
1018264284 6:162005183-162005205 TTCAAGCATGTGCTTCTTCCAGG + Intronic
1021857463 7:24871381-24871403 TTCACCCAGGGGCTTCTCCCCGG + Intronic
1023569231 7:41555160-41555182 TTCATTCTGGTGCTATTTCCTGG + Intergenic
1023656957 7:42432928-42432950 TTCAAACAGGTGCTTCTGTCAGG - Intergenic
1026219911 7:68386269-68386291 TTCATTCAGGTGTGACTTCTTGG + Intergenic
1026941692 7:74290797-74290819 TTCATTCAGCTGCTGTTACCTGG + Intronic
1027786808 7:82590423-82590445 CTTATTCAGCTGCCTCTTCCAGG - Intergenic
1028426898 7:90699734-90699756 TGCATTCAGGTGGTCCTGCCAGG + Intronic
1030314388 7:108099137-108099159 TTCTTACAGGTGTTTCTTCCAGG - Intronic
1031327272 7:120417326-120417348 ATCATACATGTGCTTTTTCCTGG + Intronic
1031824126 7:126541696-126541718 TTCTATCAGCTGCTTCTTCAAGG + Intronic
1032530622 7:132616754-132616776 TTCAAACAGGTGCATATTCCAGG - Intronic
1032564103 7:132923012-132923034 TTCATTCTGGTGTTCCTTCTTGG - Intronic
1035569751 8:664466-664488 TTTATTCACGTGTTTGTTCCTGG - Exonic
1036490183 8:9218057-9218079 TTCACTCGGCTGCTTCTTCATGG - Intergenic
1039357711 8:36839508-36839530 TTCATTCAGCTGAATCTTCGTGG + Intronic
1039761506 8:40581693-40581715 CTCATTTAGGTGTTTCTTCTAGG + Intronic
1042177415 8:66050573-66050595 TTGGGTCAGGTACTTCTTCCTGG + Intronic
1042470614 8:69183367-69183389 TTCATTCTGTTGCTGCTTCCTGG - Intergenic
1044065498 8:87693980-87694002 TTCAGTCAGGTGCTCTGTCCAGG + Intergenic
1044275415 8:90293640-90293662 TTCATTCATGTGCTTACTCTGGG - Intergenic
1053293503 9:36897456-36897478 TTTATTCAGATGAATCTTCCTGG - Intronic
1056045312 9:82708844-82708866 CTCTTTCAGGTGATTCTGCCAGG - Intergenic
1185872132 X:3673274-3673296 CTCATTCCGGGGCTTCTCCCAGG - Intronic
1186603888 X:11068623-11068645 TTCATTTAGCTGCTTGTTACGGG + Intergenic
1186648818 X:11536544-11536566 TTGACTCAGGTGCTACTTCTGGG + Intronic
1187351269 X:18519873-18519895 TTGTTTCAAGTGCCTCTTCCAGG + Intronic
1189274856 X:39778278-39778300 TCCAGTAAGATGCTTCTTCCTGG - Intergenic
1189288216 X:39866959-39866981 TTCTTACAGGTCCTTCTCCCAGG + Intergenic
1190527346 X:51341614-51341636 TTCATTCAGTTGATTCTACAGGG + Intergenic
1192830819 X:74749300-74749322 TTCATGAAGGTCCTTCTGCCTGG - Intronic
1194777120 X:97978790-97978812 TTCATTCATGTGCTCCTTCTTGG + Intergenic
1196469165 X:116006103-116006125 TTCATGCTGCTGCTTCTACCTGG - Intergenic
1197272128 X:124436394-124436416 TGCAGTCAGGTACTGCTTCCAGG - Intronic
1198096624 X:133386266-133386288 TTCTTTCAGATGATTCTACCAGG + Intronic
1200936581 Y:8743594-8743616 AGCATGCAGGTGTTTCTTCCTGG + Intergenic
1201405401 Y:13644737-13644759 TTCATTCAGGAGCTTTTGCAAGG - Intergenic
1201959740 Y:19666374-19666396 TTCCTTCAGGAGCTTCTGCAAGG - Intergenic