ID: 1076850942

View in Genome Browser
Species Human (GRCh38)
Location 10:133092715-133092737
Sequence AAGAAGCACCTGAATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076850938_1076850942 14 Left 1076850938 10:133092678-133092700 CCAGAAAAAACAAGAAAGAGAAA 0: 1
1: 0
2: 57
3: 651
4: 5881
Right 1076850942 10:133092715-133092737 AAGAAGCACCTGAATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076850942 Original CRISPR AAGAAGCACCTGAATGAAGA AGG Intronic
No off target data available for this crispr