ID: 1076851876

View in Genome Browser
Species Human (GRCh38)
Location 10:133097260-133097282
Sequence TCGGCTGTGTGATGGGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076851876_1076851886 19 Left 1076851876 10:133097260-133097282 CCTGGTGCCCATCACACAGCCGA 0: 1
1: 0
2: 2
3: 16
4: 196
Right 1076851886 10:133097302-133097324 GAAGCCGCGCCTGTCCACTCAGG No data
1076851876_1076851889 30 Left 1076851876 10:133097260-133097282 CCTGGTGCCCATCACACAGCCGA 0: 1
1: 0
2: 2
3: 16
4: 196
Right 1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG No data
1076851876_1076851885 -3 Left 1076851876 10:133097260-133097282 CCTGGTGCCCATCACACAGCCGA 0: 1
1: 0
2: 2
3: 16
4: 196
Right 1076851885 10:133097280-133097302 CGAAGGGTGGATGGAGCTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 207
1076851876_1076851884 -4 Left 1076851876 10:133097260-133097282 CCTGGTGCCCATCACACAGCCGA 0: 1
1: 0
2: 2
3: 16
4: 196
Right 1076851884 10:133097279-133097301 CCGAAGGGTGGATGGAGCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076851876 Original CRISPR TCGGCTGTGTGATGGGCACC AGG (reversed) Intronic
900707044 1:4087277-4087299 TCAGCTCTGTGCTGGGCCCCAGG + Intergenic
900740581 1:4328529-4328551 CCGGGTGTGTGGAGGGCACCTGG + Intergenic
901937582 1:12637093-12637115 CCGGCTGTGTGCTGGGTACAGGG + Intergenic
902887440 1:19416032-19416054 CCGGCTGTGTGGAGGCCACCTGG - Intronic
903326089 1:22569350-22569372 TGGGGTGAGTGATGGGCACTGGG + Exonic
903557206 1:24202680-24202702 TCGGCCCTGTGCTGGGCACAGGG + Intergenic
904417051 1:30369428-30369450 TCTACTGTGTGCTGGGGACCTGG + Intergenic
904562797 1:31410028-31410050 TGGGCTGGGTGATGGGCACAGGG + Intronic
905295917 1:36954319-36954341 GAGGCTGTGTGCTGGGCTCCAGG - Intronic
906511747 1:46413972-46413994 TCCTGTGGGTGATGGGCACCAGG - Intergenic
906650585 1:47509666-47509688 CCGTCTGTGTGCTGGGCACTGGG - Intergenic
907047069 1:51305857-51305879 CTGGCTGTGTGCTGGGCACCAGG - Intronic
907274720 1:53310837-53310859 TGGGCCCTGTGATGGGCACTGGG + Intronic
907390036 1:54152125-54152147 TTGGCAGTGGGATGGGCAGCAGG + Intronic
907645442 1:56238004-56238026 TGGGCAGTGTGATGGGCAGGTGG - Intergenic
910984954 1:92996328-92996350 TCTGCTGGATGATGGGCACCTGG - Intergenic
912462609 1:109846514-109846536 TGGCCTGTTTGATGGTCACCAGG - Intergenic
915142721 1:153777120-153777142 TCAGCTGTGTGGTGTCCACCAGG + Exonic
920730953 1:208483925-208483947 TCTGCTGTGAGCTGGGCACTGGG + Intergenic
924907773 1:248474385-248474407 TGGGCTTTGTGCTGGGGACCCGG - Intergenic
924916336 1:248573701-248573723 TGGGCTTTGTGCTGGGGACCCGG + Intergenic
1063623463 10:7668023-7668045 TGGGCTGTGTGCTGAGGACCAGG - Intergenic
1065150246 10:22815581-22815603 TAGCCTATGTGATGAGCACCTGG - Intergenic
1066532332 10:36354432-36354454 TAGGCTGAGTTCTGGGCACCAGG + Intergenic
1067000699 10:42610021-42610043 TCTGCTGTGTGATGTGTAACTGG - Intronic
1069606437 10:69741766-69741788 CAGGCTGTGTGTTGGGCACTGGG - Intergenic
1070560883 10:77565750-77565772 TGGTATCTGTGATGGGCACCAGG + Intronic
1072426054 10:95331780-95331802 TGGCCTGTTTGATGGTCACCAGG - Intronic
1073434449 10:103507794-103507816 CCTGCGGTGTGATGTGCACCTGG + Intronic
1073699375 10:105908239-105908261 TGGGGTGTGTGAGGGGCAGCAGG + Intergenic
1074879904 10:117647698-117647720 CAGCCTGGGTGATGGGCACCAGG - Intergenic
1075616664 10:123894806-123894828 TGGGCTGAGTGATGGGCAGTGGG - Intronic
1075845981 10:125545255-125545277 TCTCCAGTGTGCTGGGCACCGGG + Intergenic
1076405154 10:130206731-130206753 TGCGCTGTGGGATGGGCAGCAGG + Intergenic
1076739525 10:132476463-132476485 TGGGCTGTGTCCTGGGAACCAGG + Intergenic
1076739540 10:132476523-132476545 TGGGCTGTGTCCTGGGAACCAGG + Intergenic
1076851876 10:133097260-133097282 TCGGCTGTGTGATGGGCACCAGG - Intronic
1077633726 11:3827718-3827740 GCTGCGGTGTGATGGGCGCCTGG + Exonic
1078483267 11:11698916-11698938 TTGGCTGGGTTATGGGCACGTGG + Intergenic
1079317467 11:19421265-19421287 GCAGCTGTGTGATGGGAACCTGG - Intronic
1081733223 11:45385661-45385683 TGGGCTGGTTGCTGGGCACCAGG + Intergenic
1083298797 11:61729456-61729478 TGGGCTGTGTGCTGGGCCCTGGG - Intronic
1084494037 11:69493899-69493921 TCCGCTTTGTGAAGGGCACCTGG + Intergenic
1085272534 11:75278673-75278695 TCGGCTGTGGGCTGGGGGCCAGG + Exonic
1085516214 11:77113314-77113336 TGGGCTCTGTGTTGGGCACTGGG - Intronic
1085569790 11:77549492-77549514 TGGCCTGTTTGATGGTCACCAGG - Intronic
1086008931 11:82074699-82074721 CCTCCTGTGTGCTGGGCACCAGG + Intergenic
1089018491 11:115186968-115186990 TGGGCTCTGGGCTGGGCACCAGG - Intronic
1091369843 11:135048761-135048783 TGGCCTGTTTGATGGTCACCAGG + Intergenic
1092008135 12:5086867-5086889 GCTGGTGTGTGTTGGGCACCAGG - Intergenic
1094737833 12:33255137-33255159 TGGCCTGTTTGATGGTCACCAGG + Intergenic
1098147770 12:67515466-67515488 TGGCCTGTGTGATGGGCAAGGGG + Intergenic
1100427258 12:94498932-94498954 TGGCCTGTTTGATGGTCACCAGG - Intergenic
1102221063 12:111194729-111194751 CCTGCTGTGTGACGGGCACCGGG - Intronic
1103928654 12:124437556-124437578 TGGGCTGTGTGCCGGGCAGCAGG - Intronic
1104089498 12:125503322-125503344 GTGGCTGTGTGATGGCCATCAGG - Intronic
1104302967 12:127582140-127582162 TCTGCTCTGTGATGTGCTCCAGG + Intergenic
1110317584 13:74129079-74129101 TCTGCTGTGGGATGGGATCCTGG - Intronic
1113700143 13:112378694-112378716 TCACCTGTGGGATGGGGACCCGG + Intronic
1121469368 14:94139992-94140014 TGGGCTGTGCCAAGGGCACCTGG + Intergenic
1122075301 14:99231598-99231620 TGGACTGTGTGAGGGGCACGGGG + Intronic
1122385407 14:101341921-101341943 TGGGCATTGTGATGGGCACTGGG + Intergenic
1122738233 14:103855911-103855933 TCTACTGTGTGCTGGGCACTGGG - Intergenic
1122983818 14:105203221-105203243 CCCGCTGAGGGATGGGCACCCGG - Intergenic
1123397964 15:19955886-19955908 TCGGCCGTGTGCGGGGCTCCTGG - Intergenic
1124233529 15:27967267-27967289 TGGGCTTTGTGTTGGGCTCCAGG - Intronic
1128499085 15:68214651-68214673 TCTGCTGGGTGAGGGGCACAGGG - Intronic
1128533388 15:68470638-68470660 TCAGCTGTGTGCTGGGCCCCAGG + Intergenic
1129264099 15:74384747-74384769 TGGGCTCTGTGGTGGGGACCAGG + Intergenic
1129695893 15:77740565-77740587 TTGGCTGTGAGTGGGGCACCAGG - Intronic
1132263670 15:100447499-100447521 GCGGCTGTGTCATGGGCCACTGG + Intronic
1132394910 15:101465242-101465264 GCGGCTGTGTGCTGGGGACAGGG + Intronic
1134453231 16:14376158-14376180 CCAGCTGTGTGAGGGGCACAGGG + Intergenic
1137351219 16:47715418-47715440 TCAGCTCTGTAGTGGGCACCGGG - Intergenic
1139846771 16:69926973-69926995 TCTGCTGAGTGATGGTCACCAGG + Intronic
1140203406 16:72913132-72913154 GCAGCTGTGTGAAGGGCACATGG - Intronic
1141292933 16:82737144-82737166 TCATTTGTGTGCTGGGCACCTGG + Intronic
1143637157 17:8171852-8171874 TTGGCCGTGTGATGGGCAGGAGG - Intergenic
1143660000 17:8318884-8318906 TAGGCTGAGTGATGAGCAGCAGG - Exonic
1144830656 17:18129305-18129327 CCTGCTGTATGCTGGGCACCGGG + Intronic
1146253837 17:31376932-31376954 TAGGATGTGTCCTGGGCACCTGG - Exonic
1146928816 17:36763685-36763707 TCTGCTATGTGTGGGGCACCAGG + Intergenic
1147057216 17:37843940-37843962 TCTGGTGTGTGATAGGGACCTGG + Intergenic
1147391653 17:40112936-40112958 TGGGCTGGGTGATGGGAACAGGG - Intergenic
1148690692 17:49525146-49525168 TGGGCAGAGTGGTGGGCACCTGG - Intergenic
1149214096 17:54334029-54334051 TGGCCTGTTTGATGGTCACCAGG + Intergenic
1149997739 17:61413507-61413529 CCGGCTGGGTGATGGGACCCAGG + Intergenic
1150137721 17:62704619-62704641 TCGGCTGTGTCAGGATCACCTGG + Intronic
1152643858 17:81460003-81460025 TCGGCTGGGAGGTGGGCACGTGG + Intronic
1152734739 17:81991894-81991916 GCGGCTGTGTGCTGGGGACAAGG - Intronic
1153762933 18:8349133-8349155 TTGGCTGTGAGAGGGGCACCTGG - Intronic
1154309317 18:13255154-13255176 CCTGCTGTGTGCTGGGCACAGGG + Intronic
1157359406 18:46964031-46964053 AGGGCTGTGAGATGGGCTCCTGG + Exonic
1157361000 18:47023550-47023572 AGGGCTGTGAGATGGGCTCCTGG + Exonic
1157361990 18:47029465-47029487 AGGGCTGTGAGATGGGCTCCTGG + Exonic
1157362868 18:47034887-47034909 AGGGCTGTGAGATGGGCTCCTGG + Exonic
1157620300 18:49013324-49013346 TGGGCTGTGGGCTGGGCGCCTGG - Intergenic
1160600338 18:80007842-80007864 TGGCCTGTTTGATGGTCACCAGG + Intronic
1160721927 19:601451-601473 TCCGTTTGGTGATGGGCACCTGG + Intronic
1160793320 19:932938-932960 TGGGATGTGTGAGGAGCACCCGG + Intronic
1161389673 19:4014607-4014629 GTGGGTGCGTGATGGGCACCAGG + Intronic
1161989686 19:7677633-7677655 TAGTCTGGGTCATGGGCACCTGG - Exonic
1162123261 19:8485428-8485450 ACAGCTGTGTGGTGGGCACATGG - Intronic
1162138311 19:8569766-8569788 TTGGGTGTGTGGTGGACACCAGG + Intronic
1163577264 19:18118093-18118115 TCGGCGGTGGGATCGGCCCCAGG - Intronic
1164249431 19:23464294-23464316 TTGCCTGTGTGCTGGGCCCCAGG - Intergenic
1164428693 19:28167880-28167902 TGGGCTCTGTGCTAGGCACCAGG - Intergenic
1165169148 19:33879125-33879147 TAGGCTCTCTGATGGGCACTAGG - Intergenic
1165902305 19:39174536-39174558 CCGGCACTGTGATGGGCAACGGG - Intronic
1166196369 19:41208337-41208359 GAGGCTGGGTGATGGGCACCTGG - Intergenic
1166850785 19:45759685-45759707 CCGGCTCTGTGCTGGGCACGTGG + Intronic
1167214351 19:48154500-48154522 TCTGCTATGTGTTGGGCAGCTGG - Intronic
1168269936 19:55244322-55244344 TAGGCCCTGTGCTGGGCACCAGG + Intronic
925452184 2:3979060-3979082 TCTTCTCTGTGCTGGGCACCAGG + Intergenic
926226077 2:10967762-10967784 TCTGCTGTGTGACGGGCACCTGG + Intergenic
928270699 2:29852265-29852287 TCTGCTGTCTGATTGTCACCTGG - Intronic
935130257 2:100256422-100256444 CAGGCTCTGTGATGGGCCCCGGG - Intergenic
935559435 2:104545123-104545145 TGGTCTGTGTAGTGGGCACCAGG - Intergenic
936462011 2:112721148-112721170 CCAGCGGTGAGATGGGCACCTGG + Intergenic
937266844 2:120621954-120621976 TCTGCTGGGTGATGGAAACCCGG - Intergenic
937999179 2:127719279-127719301 TCTGCTAGGTGATGGGCCCCGGG - Exonic
939864251 2:147455246-147455268 TCTTCTGTGTGCTGGGCACTGGG + Intergenic
941993186 2:171576777-171576799 TTGGCTGTTTGATAGTCACCAGG + Intergenic
943322676 2:186465117-186465139 TGGCCTGTGTGATGGACACTTGG - Intergenic
946340235 2:219061444-219061466 CAGGCTGTGGGATGTGCACCAGG - Intergenic
1170473746 20:16693861-16693883 ACAGCTTTGTGCTGGGCACCTGG - Intergenic
1170894087 20:20398629-20398651 TGGGCAGTGTGGAGGGCACCTGG + Intronic
1171316870 20:24203084-24203106 TTGGGTGTGTGATGAGCACCTGG - Intergenic
1175871092 20:62209840-62209862 TTAGCTGTGTGATGTCCACCAGG + Intergenic
1175951605 20:62586707-62586729 GAGGCTGTGTGACTGGCACCAGG - Intergenic
1176121221 20:63455449-63455471 GGGGCTGTCTGATGGGCACGGGG - Intronic
1176264691 20:64203041-64203063 TCGGCTGTGGGGTGGGGAGCAGG + Intronic
1179521459 21:41948281-41948303 CCGGCTTTGTGCTGGGCACTGGG + Intronic
1180011280 21:45053146-45053168 CCGCCTGTGTGATGGCCAGCAGG - Intergenic
1181963854 22:26642972-26642994 TCTGCTCTGTGCTGGGCACCTGG + Intergenic
1182558276 22:31140684-31140706 TAAGCTGTGGGATGGGGACCAGG + Intergenic
1183316189 22:37138075-37138097 TCTGCTGTGTCCTTGGCACCTGG + Intronic
953760419 3:45682560-45682582 TCTGCTATGTGATGAGCACACGG - Exonic
954149275 3:48649183-48649205 GCGGCTGTGTGATGAGGCCCAGG - Exonic
956778850 3:72588645-72588667 TAGGCTGTGTGTTGGGCATTGGG + Intergenic
961385044 3:126518445-126518467 TTGGCTGTGTGAGGGAGACCCGG - Intergenic
961536897 3:127576007-127576029 TCAGCTGAGAGATGGGCATCAGG + Exonic
963223121 3:142832702-142832724 CCGGCTGTGTGCTGGGCACCTGG - Intronic
968909255 4:3469312-3469334 TGGGCTGGGTGGAGGGCACCGGG - Intronic
968933303 4:3595894-3595916 GCGGCCATGCGATGGGCACCAGG - Intergenic
968934147 4:3601239-3601261 TGGGCTGTGGGAGGGCCACCTGG - Intergenic
969252022 4:5974178-5974200 TGGGCTTTGTCATGGACACCAGG + Intronic
969269975 4:6092843-6092865 TCTACTGTGTGGTGGGCACAAGG + Intronic
969283028 4:6184253-6184275 TCTGCTATGTGCTGGGCACCTGG - Intronic
969351974 4:6603344-6603366 TGGGCTGGGTGCTGGGCCCCTGG + Intronic
969852046 4:9965264-9965286 AGGGCTGTGTAGTGGGCACCTGG - Intronic
970435890 4:16034934-16034956 TCTACTGTGTGCTGGGCACTTGG - Intronic
972244809 4:37234696-37234718 TCCTCTGTGAGATGGACACCAGG - Intergenic
973982417 4:56317162-56317184 TGGTCTGTTTGATGGTCACCAGG + Intronic
982122796 4:152158656-152158678 TGGGTTGTGTGATGGGGAACAGG + Intergenic
985516210 5:346060-346082 TCGGCTGTGTGCCTGGCCCCAGG - Intronic
989168676 5:38454241-38454263 TCAGCGGTGTGGTGGGCACCGGG + Intronic
992638402 5:78747472-78747494 GGGGGTGTGTGGTGGGCACCTGG - Intronic
992865943 5:80957266-80957288 TTAGGTGTCTGATGGGCACCTGG - Intergenic
995362925 5:111319524-111319546 CAGGCTGTGTGCTAGGCACCTGG + Intronic
996505872 5:124267090-124267112 GAGGCTGTTTCATGGGCACCGGG - Intergenic
997930310 5:138067327-138067349 TAGCCTGTTTGATGGTCACCAGG - Intergenic
999742721 5:154568825-154568847 CGGGCTGTGTGGAGGGCACCTGG - Intergenic
1000034207 5:157430845-157430867 TGGGCTTGGTGGTGGGCACCAGG + Intronic
1002462157 5:179379445-179379467 TTGCCTCTGTGGTGGGCACCAGG + Intergenic
1002568400 5:180127132-180127154 TGGGCTGTGTCCTGAGCACCGGG + Intronic
1003343771 6:5246493-5246515 TGAGCTGTGTGCTGGGCACTAGG - Intronic
1006467029 6:34201954-34201976 TGGGATGTGAGATGGGCAGCTGG + Intergenic
1007115205 6:39338631-39338653 TGGGCTGTGGTCTGGGCACCAGG - Intronic
1008424162 6:51337507-51337529 ATGGCTGTGTGACTGGCACCAGG - Intergenic
1009667360 6:66702156-66702178 TGGACTGCGTGATGGCCACCAGG - Intergenic
1010010285 6:71040861-71040883 TGGTCTGTTTGATGGTCACCAGG + Intergenic
1011746101 6:90409294-90409316 CCTGCTGTATAATGGGCACCGGG - Intergenic
1015061488 6:128971968-128971990 TCAGCTGAGAGATGGGTACCAGG + Intronic
1019460994 7:1159196-1159218 CCTGCTGTGTGTCGGGCACCGGG - Intronic
1019461064 7:1159500-1159522 CCGGCTGTCTGCTGGGGACCGGG - Intronic
1019461139 7:1159699-1159721 CCGGCTGTCTGCTGGGGACCGGG - Intronic
1019536800 7:1533584-1533606 GGGGCTGTGTGGGGGGCACCAGG + Intronic
1019659783 7:2217809-2217831 TGGGCACTGTGCTGGGCACCAGG - Intronic
1022237274 7:28474094-28474116 TCTGCTGGGTGTTGGGCAGCTGG + Intronic
1024050868 7:45622465-45622487 TCACCTGTATGATGGGAACCAGG + Intronic
1027383898 7:77641388-77641410 TGGGCTTTGTGGTGGGCACCTGG - Intergenic
1031961170 7:127991265-127991287 TGGGATGTGTGGTGGACACCAGG + Intronic
1034270945 7:149803205-149803227 TCTGGTGGGGGATGGGCACCAGG - Intergenic
1034461130 7:151198644-151198666 TCAGCAGTGTGTTGGGGACCTGG + Intronic
1035235955 7:157497843-157497865 CAGCCTGGGTGATGGGCACCAGG - Intergenic
1039354609 8:36801267-36801289 TGGTCTGCTTGATGGGCACCAGG + Intronic
1039868713 8:41528322-41528344 TCAGCTGTGTCAGGGTCACCGGG + Intergenic
1040922007 8:52631435-52631457 TGGCCTGTTTGATGGTCACCAGG - Intronic
1048277066 8:133074682-133074704 ACTGCAGTGTGCTGGGCACCAGG + Intronic
1049290463 8:141798874-141798896 TGGGCTGTGGGAGGGTCACCTGG - Intergenic
1051366832 9:16327297-16327319 TGGGCTCTGTGCTGGGAACCTGG + Intergenic
1053849688 9:42277511-42277533 ATGGATGGGTGATGGGCACCTGG + Intergenic
1054456006 9:65430740-65430762 TGGGCTGTGGGAGGGCCACCTGG + Intergenic
1058180135 9:101788068-101788090 TCTGCTGTGTGATGGACAGGGGG - Intergenic
1059384497 9:113953787-113953809 TGGGCTGTCTGGTGGGCACTGGG + Intronic
1059550316 9:115222519-115222541 TAGGATGTGTGATAGGGACCTGG + Intronic
1059702824 9:116792560-116792582 TCTGCTATCTGATGGGCACAGGG - Intronic
1059713540 9:116891694-116891716 TCTGCTGAGTGATGGGCACTTGG + Intronic
1060424316 9:123492118-123492140 TAGGCTCTGTGCTGGGCACTAGG + Intronic
1060508442 9:124215395-124215417 TGGGCTCTGTGTTGGGCACTGGG - Intergenic
1060832240 9:126723674-126723696 GAGGCTGTGTGATGGGCAAGTGG - Intergenic
1060944279 9:127560688-127560710 CCGGCGCTGTGCTGGGCACCAGG - Intronic
1061100163 9:128486076-128486098 GCTGCTGTGTGCTGGCCACCAGG + Intronic
1061879778 9:133562821-133562843 TGGGCGGCGTGGTGGGCACCCGG + Intronic
1061879816 9:133562955-133562977 TGGGCGGCGTGGTGGGCACCTGG + Intronic
1062175470 9:135159717-135159739 TCAGCTGTCTGATGGCCACTGGG + Intergenic
1185853012 X:3506898-3506920 TCGACTGTGTGACGGGTACTGGG + Intergenic
1186360340 X:8834801-8834823 TGGCCGGTGTGATGGGCTCCAGG + Intergenic
1186953301 X:14652325-14652347 TCTGCTGTGTCAAGGACACCAGG - Intronic
1189244307 X:39551608-39551630 TTGGCTCTGTGCTGGGTACCAGG + Intergenic
1190745566 X:53320266-53320288 TCGGCTGGATGAGGGGGACCTGG + Intronic
1191659581 X:63635899-63635921 TAGCCTGGGTGCTGGGCACCAGG + Exonic
1193807485 X:86012366-86012388 TGGCCTGTTTGATGGCCACCAGG - Intronic
1195688599 X:107605977-107605999 CCCTCTGTGTGATGGGCACATGG + Intergenic