ID: 1076851879

View in Genome Browser
Species Human (GRCh38)
Location 10:133097267-133097289
Sequence CCACCCTTCGGCTGTGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076851879_1076851889 23 Left 1076851879 10:133097267-133097289 CCCATCACACAGCCGAAGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 82
Right 1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG No data
1076851879_1076851885 -10 Left 1076851879 10:133097267-133097289 CCCATCACACAGCCGAAGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 82
Right 1076851885 10:133097280-133097302 CGAAGGGTGGATGGAGCTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 207
1076851879_1076851886 12 Left 1076851879 10:133097267-133097289 CCCATCACACAGCCGAAGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 82
Right 1076851886 10:133097302-133097324 GAAGCCGCGCCTGTCCACTCAGG No data
1076851879_1076851890 24 Left 1076851879 10:133097267-133097289 CCCATCACACAGCCGAAGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 82
Right 1076851890 10:133097314-133097336 GTCCACTCAGGCCTCCGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076851879 Original CRISPR CCACCCTTCGGCTGTGTGAT GGG (reversed) Intronic
900206139 1:1432679-1432701 CCATCCCTCGTCTGTGTGCTGGG - Intergenic
901020050 1:6250799-6250821 CCACCCTTTAGCTGTGAGACTGG + Intronic
902138433 1:14331282-14331304 CCACCCCTAGGCTGTGATATGGG + Intergenic
902515624 1:16987996-16988018 CCACTCTCCGGCTGTGTGGTTGG - Intronic
905873963 1:41420497-41420519 CCACCACTGGGCTGTGTGATTGG - Intergenic
905875201 1:41427791-41427813 CCACCCCCTGGCTGTGTGACTGG - Intergenic
912300482 1:108510837-108510859 CCACCCTTTGTCTGTAAGATGGG + Intergenic
915931324 1:160062428-160062450 CCGCCCCTCGGCTGTGGGACAGG - Intronic
916617637 1:166458962-166458984 CGACTCTACGGCTGTGTGCTCGG - Intergenic
919661888 1:200255630-200255652 CCACACTTCTGCTGAGTGAGAGG + Intergenic
920540994 1:206777930-206777952 CCACACTTTGGGTGTGTGATAGG - Intergenic
1067334095 10:45347251-45347273 CCACCCTTCGTCTGGGAGGTGGG + Intergenic
1067334325 10:45348086-45348108 CCACCCTTCGTCTGGGAGGTGGG + Intergenic
1069404654 10:68086062-68086084 CCACCCAGTGGCTGTGTGTTTGG - Intergenic
1072543850 10:96419136-96419158 CCACCCTGAGGCTGTGTGCAGGG - Intronic
1076851879 10:133097267-133097289 CCACCCTTCGGCTGTGTGATGGG - Intronic
1084223060 11:67696742-67696764 GCACCCTTGGGCTCTCTGATTGG - Intergenic
1084231063 11:67753607-67753629 CCAGCCTGCGGCAGTGTGCTTGG - Intergenic
1085238567 11:75033448-75033470 CCTCTCTTCGGCTGTGGTATAGG + Intergenic
1085291678 11:75404797-75404819 CCACCCTTCTGTTCTGAGATGGG - Exonic
1093512623 12:19947135-19947157 CCACCCTCCCGCTGTCTGACAGG + Intergenic
1094472184 12:30813520-30813542 TCACCCTTTTGCTGTCTGATGGG - Intergenic
1097195262 12:57239401-57239423 CCACTCTTCTGGTGTGAGATGGG + Intronic
1097627747 12:62021613-62021635 CCACCCTTCTGTTCTGAGATGGG + Intronic
1112520308 13:100089068-100089090 ACCCCCTCCGGCTGTGTGAGAGG + Exonic
1113471045 13:110546579-110546601 CCACCCTTGGTCTGTGTGACAGG + Intronic
1114553920 14:23550880-23550902 CCCCCCGCCGGCTGTGGGATGGG - Intronic
1120855905 14:89212419-89212441 GCCCCCTTTGGCTGTGTGAGTGG + Intronic
1122957325 14:105076772-105076794 CCACCCTCAGGCTGTGGGAGAGG + Intergenic
1126419274 15:48454622-48454644 CCAACCTTCACCTGTGTTATAGG - Intronic
1129873217 15:78955011-78955033 CCACTCTTCAGCTGGGTCATGGG + Intergenic
1130093429 15:80839536-80839558 CCACCCTTCTGCTGTGAGGAAGG - Intronic
1132850431 16:2022622-2022644 CCTCCCTCCGGCTCTGTGCTGGG + Intergenic
1136276186 16:29180639-29180661 CCACCCTTGTGCTGTGTGGAGGG - Intergenic
1139930144 16:70519795-70519817 TCACCCTTCAGCTAAGTGATTGG - Intronic
1140839506 16:78825938-78825960 CCACCCTTCTGTTCTGAGATGGG - Intronic
1142080565 16:88146698-88146720 CCACCCTTGTGCTGTGTGGAGGG - Intergenic
1142799679 17:2337455-2337477 CCCCCCTCCGGCTGTGGGAAGGG + Exonic
1142978820 17:3660000-3660022 CCACCCTGCGGCTGGGGCATCGG + Intronic
1147220391 17:38925467-38925489 CCACCCCCAGGCTTTGTGATTGG + Intergenic
1150804931 17:68311236-68311258 CCTCCCTTCATCTGTGTGATGGG + Intronic
1160936620 19:1599199-1599221 GCAGCCTTGGGTTGTGTGATTGG - Intronic
1162519686 19:11172524-11172546 GCTCCCTTCAGCTGTGTGTTGGG - Intronic
1164950052 19:32329593-32329615 CCACCCTTTGGCTCTTTCATGGG - Intergenic
925973354 2:9123349-9123371 CCACCTCTCGGCTGTGGGATGGG + Intergenic
932447022 2:71787423-71787445 CCAGCCTCAGGCTGTGGGATGGG - Intergenic
935251482 2:101265763-101265785 CCACGATCCAGCTGTGTGATGGG - Intronic
935949349 2:108314700-108314722 CCACCCTTGTGCTGTGTGTATGG - Intergenic
947038022 2:225882104-225882126 CCACCCTTCGGCTCTGTTATTGG + Intergenic
947168258 2:227284465-227284487 CCACCAACCGGCTGTGTGATGGG - Intronic
1169475070 20:5923667-5923689 CCTCTTTTCAGCTGTGTGATGGG - Exonic
1178428644 21:32499791-32499813 CCAGCCTGCGGCAGTGTGCTTGG + Intronic
1179070031 21:38062920-38062942 TCAGCCTTCTGCTGTTTGATAGG - Intronic
950611992 3:14132769-14132791 CACCCCTTTGGCTGTGAGATAGG + Intronic
951730230 3:25802416-25802438 CCAGTCTTTGGCTGTGTGACTGG - Intergenic
953682724 3:45051883-45051905 CCACCCTTGGGCTGTGCGTTGGG + Intergenic
955357406 3:58242504-58242526 TCCCCCTAAGGCTGTGTGATGGG + Intronic
961821554 3:129578016-129578038 CCACCCTCCGGCTGTGGCACGGG + Intronic
961879688 3:130052623-130052645 CCAGCCTGCGGCAGTGTGCTTGG - Intergenic
966848666 3:184150367-184150389 CCACCCTTCTGTTCTGAGATGGG - Intronic
969664464 4:8549194-8549216 CCACTCTACGGCACTGTGATGGG - Intergenic
969823444 4:9737947-9737969 CCAGCCTGCGGCAGTGTGCTTGG + Intergenic
972313577 4:37903847-37903869 CTACCCTTTGGGTGTGTGTTAGG - Intronic
977895156 4:102355972-102355994 CCACACCTGGCCTGTGTGATAGG + Intronic
983662929 4:170148655-170148677 ACATCCTGAGGCTGTGTGATGGG + Intergenic
989575755 5:42986743-42986765 CCTCCCTGAGGCTGTGTTATGGG - Intergenic
995797326 5:115955861-115955883 CCACCAAACAGCTGTGTGATAGG + Intergenic
998376875 5:141696787-141696809 CCCACCTGGGGCTGTGTGATAGG + Intergenic
1000585644 5:163095068-163095090 CCACTGTTCAGCTGTGTGACCGG + Intergenic
1000822861 5:166006960-166006982 CCAGCGTTGTGCTGTGTGATGGG + Intergenic
1003580770 6:7338882-7338904 CCACCCTTCTGTTCTGAGATGGG + Intronic
1006609833 6:35287710-35287732 CCACCCTGTGGCTGTGCCATCGG + Exonic
1006958931 6:37906458-37906480 CCACCTTTTGGCTGTGTGAGTGG + Intronic
1007126792 6:39432443-39432465 TCACCCTTAGGATGGGTGATGGG - Intronic
1009869078 6:69432993-69433015 CCACCCTTCATCTGGGAGATGGG - Intergenic
1011410103 6:87058830-87058852 CAGCCCCTCTGCTGTGTGATAGG - Intergenic
1012235875 6:96814528-96814550 CCTCCCACCAGCTGTGTGATTGG - Intronic
1020314709 7:6897302-6897324 CCAGCCTGCGGCAGTGTGCTTGG - Intergenic
1023855475 7:44180786-44180808 TGACCCTTAGGCTATGTGATTGG + Intronic
1024951041 7:54860630-54860652 TCACCCTGGGGCTGTATGATGGG + Intergenic
1030176671 7:106661094-106661116 CCACCCCTGGGCTTTGTCATTGG + Intergenic
1034871989 7:154693466-154693488 CCAACCTTCTGCTGTGAGCTTGG - Intronic
1035051904 7:156003856-156003878 CCACCCTTCGGCTCTGCTTTTGG - Intergenic
1037897574 8:22668488-22668510 ACACCCTTCCACTGTGGGATTGG - Intronic
1037910726 8:22742127-22742149 CCACCCCTAGGCTGTGCCATGGG + Intronic
1041392127 8:57356299-57356321 CCACCTCTCAGCTGTGAGATGGG - Intergenic
1049799810 8:144512536-144512558 TCCCCCTTTGGCTGTGTGCTTGG - Exonic
1055552279 9:77442604-77442626 ACACCCTTTGGCTCTGTGTTAGG + Intronic
1056229276 9:84527148-84527170 CCACCCTTCGTCTGGGAGGTGGG - Intergenic
1059945939 9:119408384-119408406 CCACCATCAGGCTGTGTGAATGG - Intergenic
1185516798 X:705955-705977 CCACCATTCTGCTTTCTGATTGG + Intergenic
1187844555 X:23523048-23523070 CCACCCTTCGTCTGGGAGGTGGG + Intergenic
1197096568 X:122603837-122603859 CCACACTGCTGCTGTGTGGTGGG - Intergenic