ID: 1076851883

View in Genome Browser
Species Human (GRCh38)
Location 10:133097279-133097301
Sequence CCTGAGCTCCATCCACCCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076851883_1076851893 24 Left 1076851883 10:133097279-133097301 CCGAAGGGTGGATGGAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 229
Right 1076851893 10:133097326-133097348 CTCCGTCAGGGTCTTCTCCACGG No data
1076851883_1076851889 11 Left 1076851883 10:133097279-133097301 CCGAAGGGTGGATGGAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 229
Right 1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG No data
1076851883_1076851890 12 Left 1076851883 10:133097279-133097301 CCGAAGGGTGGATGGAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 229
Right 1076851890 10:133097314-133097336 GTCCACTCAGGCCTCCGTCAGGG No data
1076851883_1076851886 0 Left 1076851883 10:133097279-133097301 CCGAAGGGTGGATGGAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 229
Right 1076851886 10:133097302-133097324 GAAGCCGCGCCTGTCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076851883 Original CRISPR CCTGAGCTCCATCCACCCTT CGG (reversed) Intronic
900550189 1:3250686-3250708 CCTGAGCCCCCTGCACCCTCAGG - Intronic
900651529 1:3732405-3732427 CCTGAGCTCCCAACACCCTCTGG - Intronic
901826734 1:11866846-11866868 GCTGAGCCTCATCCACCCCTAGG - Intergenic
902087901 1:13877266-13877288 CCTGAGCTCTTTCCTCCCTCAGG - Intergenic
902162224 1:14540306-14540328 CCTGAGCCCCTTCCTCTCTTAGG + Intergenic
902219625 1:14956829-14956851 CCTCAGCCCCAACCACCCCTCGG - Intronic
902732286 1:18377345-18377367 TCTGAAGGCCATCCACCCTTTGG + Intronic
902821507 1:18946137-18946159 CCTGAGCTCTACCCACACTGCGG - Intronic
902891565 1:19448028-19448050 CCTGAGCTCCACCCACTCCTGGG - Intronic
903277882 1:22233221-22233243 CCTGAGCTCCATAGCCCCTCAGG + Intergenic
903296252 1:22345007-22345029 CATCAGCTCCATCCACCCCCTGG + Intergenic
904263590 1:29305126-29305148 CCTGAGCAGCATACACTCTTAGG + Intronic
904936086 1:34130731-34130753 CCTGCCCTCCACCCATCCTTAGG + Intronic
905897875 1:41560545-41560567 CTGGAGCTTCATGCACCCTTGGG + Intronic
907366668 1:53966678-53966700 CCTGGGCTGCTTCCACCCTCTGG - Intronic
908945907 1:69496615-69496637 CATTAACTCCATCCACCCTCTGG - Intergenic
911580401 1:99627031-99627053 CCTGGGCTCAAGCCATCCTTTGG - Intergenic
915274944 1:154782051-154782073 TCTAAGCTCCATCCTGCCTTGGG - Intronic
915329214 1:155099314-155099336 CCTGAGCTCAAGCCATCCTCCGG + Intergenic
915400788 1:155620218-155620240 CCTGAGCTCAAGCCATCCATCGG + Intergenic
915579359 1:156804250-156804272 TCTGAGCTCCACCACCCCTTTGG + Intergenic
916126013 1:161572060-161572082 CCTGAGATCCACCCACTCCTGGG + Intergenic
916135929 1:161653907-161653929 CCTGAGATCCACCCACTCCTGGG + Intronic
917489852 1:175488821-175488843 CCCTTGCCCCATCCACCCTTCGG - Intronic
919249214 1:195030779-195030801 CCTGAGCCCCATTCAGACTTTGG - Intergenic
922431591 1:225560211-225560233 CATGAGCTACCTCCAGCCTTGGG - Intronic
922542010 1:226426929-226426951 CCTGGGCTCAATCCACCCTCTGG + Intergenic
923193671 1:231643849-231643871 CCAGGGCTCCATTCACCCCTCGG - Intronic
923535854 1:234851298-234851320 CCTGGGCTCCAGCCATCCTTTGG - Intergenic
923870862 1:237992645-237992667 CCTGAGCTCCTTCAAGCCTAGGG + Intergenic
1064065822 10:12180712-12180734 CCAGAGCTCCAGCCTCCCTGAGG + Intronic
1066044365 10:31583027-31583049 CCTGAGCTGCAGTCACCTTTGGG + Intergenic
1066687221 10:37992759-37992781 CCTGTGCTCTATGCACCCTTGGG + Intergenic
1067520083 10:46993303-46993325 CCTGTGCTCTCTCCTCCCTTGGG + Intronic
1067533546 10:47091953-47091975 CCTGAGCCCCATGCACGCATTGG + Intergenic
1067570292 10:47366643-47366665 CCTGGGCTCCACACATCCTTAGG + Exonic
1068492125 10:57737570-57737592 TCAGGGCTCCATCCACCCTCAGG + Intergenic
1068763547 10:60737977-60737999 CCTGGGCTCAAGCAACCCTTTGG + Intergenic
1069753917 10:70761856-70761878 CCTGGGGTCCAACCACCCCTGGG - Exonic
1070991736 10:80739248-80739270 CCTGATCTCCCTTCACCCTCAGG - Intergenic
1071335972 10:84600849-84600871 CCTCAGCTCCATCTTCCCATAGG + Intergenic
1071490860 10:86135461-86135483 CCTCAGCCCCATCCTCCCTGAGG + Intronic
1072022898 10:91421576-91421598 CCTGGGCTGCATGCACCCTGGGG + Intronic
1074538561 10:114346120-114346142 CCTGCGCTCCTTCAACCCTGGGG - Intronic
1074866588 10:117547493-117547515 CCTGAGCTGCATCCTCCGTGCGG - Intronic
1075001074 10:118798307-118798329 ACAGAGCTCGATCCACCCTCAGG - Intergenic
1075077132 10:119359093-119359115 CCTGAGCCCCCTCCACTGTTTGG + Intronic
1075615745 10:123890056-123890078 TCTGAGCCTCACCCACCCTTCGG + Intronic
1076437079 10:130453828-130453850 CCTGGGCTCCTTCCACCCAGGGG + Intergenic
1076559160 10:131349881-131349903 TCTAAGCTGCATTCACCCTTGGG + Intergenic
1076834913 10:133016212-133016234 CCTCAGCACCACCCACCCTCAGG + Intergenic
1076851883 10:133097279-133097301 CCTGAGCTCCATCCACCCTTCGG - Intronic
1077017742 11:404400-404422 CCTGGTCTCCATCCTCCCATGGG - Intronic
1078339078 11:10486231-10486253 CCTGTGCTCCGTCCACTCTGGGG + Intronic
1082664638 11:55960280-55960302 CCTGAGCTCAAGGCACCCTCAGG + Intergenic
1084540018 11:69780469-69780491 CCTGAGCTGCTCCCACCTTTTGG + Intergenic
1085068641 11:73521439-73521461 TCTAATCTCCTTCCACCCTTGGG - Intronic
1085836572 11:79963079-79963101 GTTGAGCTCCATCCAGCTTTGGG - Intergenic
1091164522 11:133462912-133462934 CCTGAGTTGCTTCCACCTTTTGG - Intronic
1092984089 12:13828480-13828502 CCGGAGCTCCTTCTAACCTTAGG + Intronic
1094750960 12:33407696-33407718 CCTGAGCTCAAGCCATCCTCTGG + Intronic
1096244563 12:49976862-49976884 CCTGGGTTCCTACCACCCTTAGG - Exonic
1096268423 12:50143517-50143539 CCTGGGCTCAAGCCATCCTTCGG - Intronic
1097208755 12:57348194-57348216 CCTGGGCTCAATCGATCCTTAGG - Intronic
1099120686 12:78686082-78686104 CCTGAGCTCAAGCCATTCTTGGG + Intergenic
1099814296 12:87625398-87625420 CCTGAGCTCCATCTCCCGTCAGG + Intergenic
1099828625 12:87811962-87811984 CCAGAGCCCCATCCATTCTTGGG + Intergenic
1099999338 12:89814179-89814201 CCTTAGCTCCAACTACCCCTGGG - Intergenic
1100407266 12:94282629-94282651 CCTGAACTCTCTCCACCCTGAGG + Intronic
1101837781 12:108307181-108307203 CCCCAGCACCAGCCACCCTTTGG - Intronic
1103012043 12:117465256-117465278 CCTGAGCCCCAGCCACTCTGGGG - Exonic
1104069137 12:125329506-125329528 CCCAAGCTCCCTCCACCCTTGGG + Intronic
1104226668 12:126841483-126841505 TCTGATCTCCATCCACCCCCAGG - Intergenic
1106552541 13:30784675-30784697 ACTGAGCTCCATCCCCACGTAGG - Intergenic
1108249545 13:48551003-48551025 CCTCAGCTCCCTCCAGACTTTGG + Intergenic
1110295590 13:73860505-73860527 CCTGAGCTCGAGCAACCCTTCGG - Intronic
1110417916 13:75272143-75272165 CCTGAGTTGCTTCCACCTTTTGG - Intergenic
1110684772 13:78358968-78358990 ACAGTGCTCCATCCACCCTCTGG + Intergenic
1113745711 13:112742733-112742755 CCTGAGATCCAGCCACACTGCGG - Intronic
1116763829 14:49047081-49047103 CCAGAGCTCCATATAACCTTAGG - Intergenic
1116997360 14:51337605-51337627 CCTGAGCTCCGCCCACCCTGAGG - Intergenic
1117001888 14:51378423-51378445 CCTGGGCTCCATCGATCCTCTGG - Intergenic
1117650441 14:57899630-57899652 GCTGTGCTCCATTCAGCCTTGGG - Intronic
1117979787 14:61331032-61331054 CCTGAGCTGCATGCAGCCTATGG + Intronic
1118885204 14:69860250-69860272 CCTGATCCCCATCCACCCAGAGG - Intronic
1119909193 14:78334371-78334393 CTTGATCTGAATCCACCCTTAGG - Intronic
1121122494 14:91384830-91384852 CGTGGGCTTCATCCACCCTTGGG - Intronic
1121336618 14:93081738-93081760 CCAGAGCCCCAGACACCCTTTGG - Intronic
1121607661 14:95253138-95253160 CCTGAGCTCCATGCCCACTGTGG + Intronic
1121974364 14:98389256-98389278 CCTGAGTTTCTTCCACCTTTTGG + Intergenic
1122075735 14:99233466-99233488 CCTGGGCTCAATCCAGCCATTGG + Intronic
1125106644 15:35979433-35979455 CCTGACCTCCCTCCTACCTTAGG - Intergenic
1125536469 15:40443291-40443313 CCTCAGCTCCATCCAGGCTGGGG - Intronic
1126348392 15:47719064-47719086 TTTGTGCTCCATCCACTCTTGGG + Intronic
1128028991 15:64462539-64462561 CCTGGGCTCCAGCCATCCTCTGG - Intronic
1130062612 15:80580688-80580710 CAGGAGCACCATCCACCCTCAGG + Intronic
1130569642 15:85030102-85030124 ATTGAGCTCCAACCTCCCTTTGG + Intronic
1132744312 16:1430387-1430409 CCTCAGCTGCAGCCACCCCTGGG - Intergenic
1133314082 16:4871280-4871302 CCTGGCCTGCATCCAGCCTTTGG - Exonic
1134125802 16:11615192-11615214 CCAGAGCCCCATCTACCCTGGGG + Intronic
1134683554 16:16143264-16143286 CCTGGGCTCCGTCCACCTTGCGG - Intergenic
1136129201 16:28208917-28208939 CCTGGGTTGCTTCCACCCTTTGG - Intronic
1136417567 16:30113142-30113164 TCTGGGCTCCATCCTCCCTCTGG + Intronic
1136559317 16:31029492-31029514 CCCGTGTTCCACCCACCCTTGGG - Intergenic
1142302392 16:89266285-89266307 ACTGTGCTCCATCCAGCCTGGGG + Intergenic
1143848487 17:9791365-9791387 GCTGAGCTCCCTGCAGCCTTGGG - Intronic
1144391392 17:14796782-14796804 CCTGAGTTCCAGCAAACCTTTGG - Intergenic
1144563633 17:16342377-16342399 CCTGGGCTCGATCAACCCTCCGG + Intronic
1145037505 17:19551560-19551582 AGTGAGCTCCCTCCACCCTGGGG - Intronic
1146018327 17:29251391-29251413 CCTGAGCTGCATGCAGCCCTTGG + Intronic
1146066476 17:29639683-29639705 CATGAGCTCCAGCCACCCCTAGG + Intronic
1147137549 17:38442950-38442972 CCAGCGCTCCATCCCCCCATCGG - Intronic
1147546296 17:41404562-41404584 CTTAAGCTCCCTCCAGCCTTGGG + Intergenic
1149133245 17:53333800-53333822 CATCATCTCCTTCCACCCTTTGG + Intergenic
1149572711 17:57685005-57685027 CCTTAGCTCCTTCCACCATCTGG - Intergenic
1151968559 17:77445142-77445164 CCACAGCTCCTGCCACCCTTGGG - Intronic
1154166215 18:12016326-12016348 CCTGAAGTCCATCTACCCATAGG - Intronic
1155369120 18:25079331-25079353 CCTGGCCTCCATCCACGCTCAGG + Intronic
1155921178 18:31604247-31604269 CATGAATTCCATCCACCTTTTGG - Intergenic
1157328689 18:46687582-46687604 GCTCAGCACCATCCTCCCTTAGG + Intronic
1158518962 18:58154407-58154429 GCTGAGCTCAAACCACCCTTTGG + Intronic
1159012578 18:63071925-63071947 CCTGAGCTCCCAGCACCGTTTGG + Intergenic
1160115722 18:76077591-76077613 CCTCAACTCCATCGACCCTACGG - Intergenic
1160770315 19:828134-828156 CCTCAGCTCTATCCACCCAGTGG - Intronic
1163629156 19:18408270-18408292 CCTCCGCTCCCTCCACCCTCAGG + Intergenic
1163751105 19:19078364-19078386 CCTGAGCTCACTCCAGCCTTGGG + Intronic
1164656049 19:29922762-29922784 CCCCAGCTCCATTCACCCTTGGG + Intergenic
1164882701 19:31748379-31748401 TCTGGGCTGCTTCCACCCTTTGG + Intergenic
1165065548 19:33226032-33226054 CCTGAGTTACATCCATTCTTGGG + Intergenic
1165121910 19:33565344-33565366 AGTGAGCTCCATCTGCCCTTGGG + Intergenic
1168156105 19:54473728-54473750 ACTGAGCTGCATCCTGCCTTGGG - Intergenic
1168174645 19:54616565-54616587 CCTGAGCCCCGACCTCCCTTTGG + Intronic
1168254843 19:55159650-55159672 CCAGAGCCCCATCCTCCCTCCGG - Intronic
927143198 2:20143524-20143546 CCTGGGCTCCCTCTACCCTAGGG + Intergenic
928396636 2:30947660-30947682 CCTCTGCACCAACCACCCTTTGG + Intronic
929200979 2:39235515-39235537 CCTGAGCTCAATCAATCCTCAGG - Intergenic
929602212 2:43211371-43211393 CCTGAGCTCAAGCCATCCTCCGG - Intergenic
932483312 2:72063307-72063329 ACTGGGCTTCATACACCCTTTGG + Intergenic
934612441 2:95751320-95751342 CATGAGCTGCATCCTGCCTTGGG - Intergenic
934648477 2:96073100-96073122 CATGAGCTGCATCCTGCCTTGGG + Intergenic
934841711 2:97628124-97628146 CATGAGCTGCATCCTGCCTTGGG + Intergenic
934935052 2:98459302-98459324 CCTGAACTCTACCCTCCCTTAGG - Intronic
935654704 2:105412161-105412183 CCTGGGCTGCATCCACCTGTTGG - Intronic
939061702 2:137430551-137430573 CCTGAGTTTCTTCCACCCTCAGG - Intronic
942958869 2:181805992-181806014 CCTGAGGTCCCTCCAAACTTGGG - Intergenic
945330172 2:208530073-208530095 CCTCAGCTCCCTCCAGACTTTGG - Intronic
946183060 2:217960466-217960488 CCTGCCCTGCATCCACCCCTGGG - Intronic
948214354 2:236217367-236217389 CCTGAACTCCATCCAGCCTGGGG + Intronic
1170845949 20:19962071-19962093 CCTGAGCTCAAGCAACCCTCTGG - Intronic
1171217193 20:23361417-23361439 CCAGAGACCCATCCACTCTTCGG - Intergenic
1171868260 20:30506203-30506225 CCTCAGCTGCAGCCAGCCTTTGG + Intergenic
1172485501 20:35295589-35295611 CCTGAGTTGCTTCCACCTTTTGG + Intergenic
1172593448 20:36133231-36133253 GCTGAGATCCAACTACCCTTTGG + Intronic
1175024645 20:55888995-55889017 CCTGAGCTCCTTCCATCCTTTGG - Intergenic
1176053177 20:63131255-63131277 CCTGAGCTGCACCCACCCTGGGG - Intergenic
1176372509 21:6070870-6070892 CCGGAGCTCCAGCCACCATCAGG - Intergenic
1178858192 21:36267582-36267604 CCTGGGCTCAAGCCATCCTTAGG - Intronic
1179721929 21:43321129-43321151 CCTGAGCTCCTTCCTCCCAGAGG + Intergenic
1179750967 21:43467375-43467397 CCGGAGCTCCAGCCACCATCAGG + Intergenic
1180938965 22:19644491-19644513 CCTGAGATCCTCCCTCCCTTAGG - Intergenic
1181051475 22:20240181-20240203 CCTGAGCTGCCCCCAGCCTTGGG + Intergenic
1181517228 22:23421938-23421960 CCTGAGCCTCAACCACCCTCAGG - Intergenic
1182356780 22:29725791-29725813 CCTGAACTCCATCCAGGCTAGGG - Intronic
1182376612 22:29853154-29853176 CCTTAGCTGTAGCCACCCTTTGG + Intergenic
1183830156 22:40414453-40414475 CCTGGGCTGTTTCCACCCTTTGG - Intronic
1184387941 22:44186857-44186879 CCCCAGCTCCATCGCCCCTTGGG - Intronic
1184514313 22:44952479-44952501 CCTGTGCTCCCTCCACCCCCAGG - Intronic
1185067493 22:48639518-48639540 GCTGAGCTCCAGACACCCTGAGG + Intronic
1185179487 22:49350858-49350880 CCTGGGCTGCTTCCACCCTCTGG - Intergenic
950449771 3:13059065-13059087 CCTGGGCTCCCTCCACCCTTTGG + Intronic
950501255 3:13365351-13365373 CCTGACCCCCACCCACTCTTGGG - Intronic
950634951 3:14308013-14308035 CCTGGTCTCCATCCCTCCTTGGG + Intergenic
953759894 3:45678434-45678456 CCTCAGCTCCTGCCACCCTGGGG - Exonic
954614315 3:51961778-51961800 TCTGTGCTCCATCCACCATCTGG - Intronic
955353849 3:58214372-58214394 CTTGAGCAACATCCACTCTTGGG + Intronic
955496072 3:59533891-59533913 GCTGAGCTCCAACCTTCCTTGGG + Intergenic
957508303 3:81154924-81154946 CATCAGCTCCATCCACGGTTTGG - Intergenic
958476080 3:94584857-94584879 CCTGAGCCGCATGCACCCTGTGG + Intergenic
958562086 3:95759810-95759832 CCTCAGCTCCCTCCAGGCTTTGG - Intergenic
960825107 3:121774511-121774533 CTTGGGTTCCGTCCACCCTTTGG - Intronic
962630211 3:137268106-137268128 CCTTAGCTTGACCCACCCTTAGG - Intergenic
964915039 3:161830157-161830179 CCTGAGCACCATTCACAATTTGG - Intergenic
966396512 3:179509617-179509639 CTTGGCCTCCATTCACCCTTTGG + Intergenic
966943425 3:184760827-184760849 CCTGAGCCCCAGCTACCCTCTGG - Intergenic
967818793 3:193821350-193821372 CTTGAGTTGCCTCCACCCTTTGG + Intergenic
968019079 3:195367791-195367813 GCTGAGCTTCTTTCACCCTTTGG - Intronic
968936913 4:3615988-3616010 CCTGAGGTCCACCCACCATGGGG - Intergenic
969348639 4:6585038-6585060 CCTGTGCTCCCCCCACCCTCTGG + Intronic
969374638 4:6755238-6755260 TGTGAGCTCCACCCACCCTGGGG + Intergenic
969992096 4:11275204-11275226 CCTGAACTCCACCTAACCTTTGG + Intergenic
970793432 4:19887405-19887427 CCTTTGCCCCATCCTCCCTTGGG + Intergenic
970819234 4:20193404-20193426 CCTGAACTCCTTTCACCCTTTGG - Intergenic
971472295 4:27040277-27040299 CCTGAGCTTCAACTTCCCTTGGG + Intergenic
972404798 4:38735474-38735496 CCTGTGCTCCCTCCATCCTGTGG + Intergenic
972752791 4:42008836-42008858 CCTAAGCCTCATCCTCCCTTTGG + Intronic
975819138 4:78252282-78252304 CCTGAGCTCCATCCTTAATTTGG + Intronic
976225156 4:82790048-82790070 CCTCAGCTCCATGCAGCCTGAGG + Intronic
976501051 4:85789401-85789423 CCTGAACTCCAGCCAACCTGCGG - Intronic
979680259 4:123451670-123451692 CCTGAGCTCAAGCCATCCTCTGG - Intergenic
982106118 4:152013542-152013564 CATGAGCTGAATCCACCCTTGGG - Intergenic
984514291 4:180719441-180719463 CCTGAGCTCTGGACACCCTTGGG - Intergenic
985652613 5:1113885-1113907 CCTGAGCTCTGTCCAACCCTCGG - Intergenic
985697012 5:1346370-1346392 CCTGCTCTCCAGCCACTCTTGGG + Intergenic
986345069 5:6827078-6827100 CCTGAGCTGCTCTCACCCTTTGG + Intergenic
989153497 5:38322337-38322359 CCTGTGCTCCATCCACTCCTTGG - Intronic
989477030 5:41885477-41885499 TCTGAGCTTCCTCCAGCCTTAGG + Intergenic
991244036 5:64489968-64489990 CCAGTGCTCCACCCCCCCTTAGG + Intergenic
992152086 5:73914816-73914838 CCTGGGCTCCATCCACCTCCTGG + Intronic
993989093 5:94634313-94634335 CCCCACCTCCATCCAGCCTTTGG + Intronic
995532981 5:113109245-113109267 CCTGGGCTACTTCCACCTTTTGG - Intronic
997230400 5:132238436-132238458 GTTGAGCTCCATGCACCCTCTGG - Intronic
997995916 5:138586367-138586389 CCTGAGCTCAAGCCATCCTCTGG - Intergenic
998030721 5:138865284-138865306 TCTAGGCTCCACCCACCCTTGGG + Intronic
998454166 5:142257933-142257955 CCTGAGCTCAAGCAATCCTTTGG + Intergenic
998590343 5:143471492-143471514 CCTGGGCTTCCTTCACCCTTGGG - Intergenic
999373454 5:151070045-151070067 CCTCAGCTCTGTCCACCCTGTGG + Intronic
1003438929 6:6121909-6121931 CCTCAGCTCCCTCCAGACTTTGG + Intergenic
1006893755 6:37452521-37452543 CCTGAGCTCCAGTCACCTTATGG - Intronic
1014940872 6:127437066-127437088 CCTGAGCTCCATCTACGGTGGGG - Intergenic
1016426573 6:143941951-143941973 CCTGGCCTCCCTCCACCCCTCGG - Exonic
1022486618 7:30784050-30784072 CCTGAGCTTCAGCGACCCTCAGG - Intronic
1023394078 7:39736049-39736071 CCAGACCTCCATGCACCCTAGGG - Intergenic
1026246625 7:68626170-68626192 CCTCAGCTCCATTCACCCCTTGG + Intergenic
1027614351 7:80402932-80402954 TCTCAGCTCCCTCCACCTTTGGG - Intronic
1029548064 7:101221810-101221832 CCTGAGCCCTGTCCACCCTGTGG - Intronic
1029686812 7:102154073-102154095 CCTGAGCTCAAGCAACCCTCTGG - Intronic
1034120909 7:148627004-148627026 CCTGAGCTCAAGCAATCCTTCGG - Intergenic
1036473308 8:9070393-9070415 CCTGGGCTCAAGCCATCCTTTGG - Intronic
1039887005 8:41660508-41660530 TCTGATCTCCATCCTCCCTGGGG - Intronic
1045248292 8:100462063-100462085 CCTGGGCTCAAGCGACCCTTTGG + Intergenic
1045826969 8:106409269-106409291 CCTCCTCTCCATCCTCCCTTTGG - Intronic
1048324644 8:133429570-133429592 CCTGACTTCCATCCAGCCTGAGG - Intergenic
1049398736 8:142415335-142415357 CGTGAGCTCCATACACACTAGGG - Intergenic
1052784784 9:32818354-32818376 CCTGTGCTCGATCCATCCATGGG - Intergenic
1055219704 9:73913877-73913899 CCTGATATCCATCCTCCCCTGGG + Intergenic
1057226168 9:93294422-93294444 CTTGGGCTCCATCCACTCTCTGG - Intronic
1059745429 9:117195818-117195840 CATGAGTTCCCTGCACCCTTGGG + Intronic
1061729637 9:132603840-132603862 CCTGAGCTTCCTCCACACCTGGG - Intronic
1061902500 9:133680274-133680296 CCTGAGCTCCACCGAGCCTTGGG + Intronic
1062590772 9:137273572-137273594 TCTGAGCTACATCCAACCTCAGG - Intergenic
1186538712 X:10376917-10376939 CCTGATCTCCATCTTCGCTTTGG - Intergenic
1187365689 X:18664255-18664277 CATGAGATGCATCCACCCTGTGG - Intronic
1189170734 X:38906876-38906898 CCTGAGCTCAAGCCATCCTCTGG - Intergenic
1189297441 X:39929038-39929060 CTTGGGGTCCATCCACTCTTGGG - Intergenic
1190630543 X:52381363-52381385 CCTGAGCTACCTCCACTCTGTGG - Intergenic
1190726379 X:53193193-53193215 CCTGAGCTCCGTACCCTCTTTGG + Exonic
1195625686 X:107003979-107004001 TCTGTGCTCCATCCACTCTGTGG - Intergenic
1196173619 X:112616803-112616825 CCTGTGCTCTATGCAGCCTTGGG + Intergenic
1198419159 X:136451719-136451741 CCTGAGGTCCATCAAACTTTAGG + Intergenic
1198739518 X:139826194-139826216 ACTGAGCAGCATGCACCCTTTGG + Intronic
1199984978 X:152944007-152944029 TCTGTGCTGCTTCCACCCTTAGG - Intronic