ID: 1076851889

View in Genome Browser
Species Human (GRCh38)
Location 10:133097313-133097335
Sequence TGTCCACTCAGGCCTCCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076851879_1076851889 23 Left 1076851879 10:133097267-133097289 CCCATCACACAGCCGAAGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 82
Right 1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG No data
1076851883_1076851889 11 Left 1076851883 10:133097279-133097301 CCGAAGGGTGGATGGAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 229
Right 1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG No data
1076851876_1076851889 30 Left 1076851876 10:133097260-133097282 CCTGGTGCCCATCACACAGCCGA 0: 1
1: 0
2: 2
3: 16
4: 196
Right 1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG No data
1076851881_1076851889 22 Left 1076851881 10:133097268-133097290 CCATCACACAGCCGAAGGGTGGA 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076851889 Original CRISPR TGTCCACTCAGGCCTCCGTC AGG Intronic
No off target data available for this crispr