ID: 1076855730

View in Genome Browser
Species Human (GRCh38)
Location 10:133114878-133114900
Sequence CCCTGAGGCTGCGGTTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076855719_1076855730 9 Left 1076855719 10:133114846-133114868 CCTGCGCCCCTGCACCACCAATC No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855722_1076855730 2 Left 1076855722 10:133114853-133114875 CCCTGCACCACCAATCCAGGCAG No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855721_1076855730 3 Left 1076855721 10:133114852-133114874 CCCCTGCACCACCAATCCAGGCA No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855713_1076855730 24 Left 1076855713 10:133114831-133114853 CCTGCTCCGCCCGCCCCTGCGCC No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855717_1076855730 11 Left 1076855717 10:133114844-133114866 CCCCTGCGCCCCTGCACCACCAA No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855725_1076855730 -8 Left 1076855725 10:133114863-133114885 CCAATCCAGGCAGCTCCCTGAGG No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855715_1076855730 15 Left 1076855715 10:133114840-133114862 CCCGCCCCTGCGCCCCTGCACCA No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855723_1076855730 1 Left 1076855723 10:133114854-133114876 CCTGCACCACCAATCCAGGCAGC No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855714_1076855730 18 Left 1076855714 10:133114837-133114859 CCGCCCGCCCCTGCGCCCCTGCA No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855724_1076855730 -5 Left 1076855724 10:133114860-133114882 CCACCAATCCAGGCAGCTCCCTG No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855712_1076855730 29 Left 1076855712 10:133114826-133114848 CCGGTCCTGCTCCGCCCGCCCCT No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855711_1076855730 30 Left 1076855711 10:133114825-133114847 CCCGGTCCTGCTCCGCCCGCCCC No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855718_1076855730 10 Left 1076855718 10:133114845-133114867 CCCTGCGCCCCTGCACCACCAAT No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data
1076855716_1076855730 14 Left 1076855716 10:133114841-133114863 CCGCCCCTGCGCCCCTGCACCAC No data
Right 1076855730 10:133114878-133114900 CCCTGAGGCTGCGGTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076855730 Original CRISPR CCCTGAGGCTGCGGTTTCCT TGG Intronic