ID: 1076856259

View in Genome Browser
Species Human (GRCh38)
Location 10:133116793-133116815
Sequence GACTCGGAACTGACCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076856259_1076856269 20 Left 1076856259 10:133116793-133116815 CCAGCTCTGGTCAGTTCCGAGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1076856269 10:133116836-133116858 CCTCGAGCAGAGACTCCTCCAGG No data
1076856259_1076856265 -9 Left 1076856259 10:133116793-133116815 CCAGCTCTGGTCAGTTCCGAGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1076856265 10:133116807-133116829 TTCCGAGTCAGGCAAGGGGTGGG No data
1076856259_1076856267 -5 Left 1076856259 10:133116793-133116815 CCAGCTCTGGTCAGTTCCGAGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1076856267 10:133116811-133116833 GAGTCAGGCAAGGGGTGGGCAGG No data
1076856259_1076856264 -10 Left 1076856259 10:133116793-133116815 CCAGCTCTGGTCAGTTCCGAGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1076856264 10:133116806-133116828 GTTCCGAGTCAGGCAAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076856259 Original CRISPR GACTCGGAACTGACCAGAGC TGG (reversed) Intronic
900473384 1:2865172-2865194 GACTCGCCTCTGACCAGCGCTGG + Intergenic
902277611 1:15350752-15350774 GACTCTGACCTCACCAGGGCAGG - Intronic
904417638 1:30372917-30372939 GACCCAGAACTGACCAGGCCTGG - Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
914333788 1:146697362-146697384 GACTTGGAACTCAGCAGAGGGGG - Intergenic
915786370 1:158617262-158617284 GACTCTGATCTGCCCAGAGTGGG - Intronic
916651184 1:166836139-166836161 TCCAAGGAACTGACCAGAGCAGG + Intergenic
918199732 1:182255833-182255855 CACTTGGAACTGAGCAAAGCAGG - Intergenic
920498102 1:206469707-206469729 ATCTCTGAGCTGACCAGAGCAGG + Intergenic
921769326 1:219016977-219016999 GAATCACAACTGACCAGAGCTGG + Intergenic
1073791191 10:106942126-106942148 GAATGGGAACTGGTCAGAGCAGG - Intronic
1074317963 10:112376249-112376271 GACTCGGGACAGCTCAGAGCAGG + Exonic
1074604300 10:114945197-114945219 GATTTGGAACTGAGCAGATCTGG - Intronic
1075452627 10:122562544-122562566 AACTCGGTACTGACAAGAGCTGG - Intronic
1076856259 10:133116793-133116815 GACTCGGAACTGACCAGAGCTGG - Intronic
1088837591 11:113591002-113591024 CACTCAGAACAGAACAGAGCTGG - Intergenic
1089655479 11:119943967-119943989 GACTCGGGCCTGGCCAGAGAAGG - Intergenic
1090619258 11:128547122-128547144 CCCTTGGGACTGACCAGAGCAGG + Intronic
1091337211 11:134781446-134781468 CACTCTGCACTGACCACAGCTGG - Intergenic
1091397169 12:161077-161099 GACGTGGAAGAGACCAGAGCAGG + Intronic
1092110058 12:5953735-5953757 GACTGAGAACTGACAAAAGCTGG - Intronic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1122533389 14:102445032-102445054 GACTTGGAACTGATGAGAGCAGG - Intronic
1124407345 15:29404436-29404458 GACCCAGAACTGACCAGACAGGG - Intronic
1124654647 15:31498578-31498600 CAGTAGGAACTGACCTGAGCTGG + Intronic
1128649927 15:69403081-69403103 GACTCTGAGCTGATCAGTGCTGG + Intronic
1131056341 15:89377546-89377568 GATTCGGAACCTTCCAGAGCTGG - Intergenic
1132575500 16:661979-662001 GACACAGACCTGGCCAGAGCTGG - Exonic
1132918007 16:2364597-2364619 GCCTTGGAACTGAGCACAGCAGG + Intergenic
1136672959 16:31874213-31874235 GACGCGGAGCTGCCCAGAGAGGG - Intronic
1139999829 16:71013887-71013909 GACTTGGAACTCAGCAGAGGGGG + Intronic
1142127115 16:88415670-88415692 CGCCCGGAAGTGACCAGAGCTGG + Intergenic
1142601770 17:1056542-1056564 GGCTGGGAACTGACCGGAGTGGG - Intronic
1143194808 17:5067735-5067757 GGCACAGAACTGACCAGAGATGG - Intergenic
1147762706 17:42810539-42810561 GAATCAAAACTGACCAGGGCTGG + Exonic
1152912594 17:83013627-83013649 GACCAGGATGTGACCAGAGCCGG + Intronic
1153803491 18:8691988-8692010 GACCAGGAACTGACCAGAACTGG + Intergenic
1157291065 18:46410166-46410188 AAATGGGATCTGACCAGAGCAGG - Intronic
1160777494 19:862701-862723 GAGTGGGGACTGAGCAGAGCAGG + Intronic
1162601658 19:11674416-11674438 GGCGCGGAGCTGACCAGAGAGGG - Intergenic
1162635692 19:11965446-11965468 GGCGCGGAACTGCCCAGAGAGGG - Intronic
1162691945 19:12440668-12440690 GGCTCGGAGCTGCCCAGAGAGGG + Intronic
1162696985 19:12484393-12484415 GGCTCGGAGCTGCCCAGAGAGGG + Intronic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
927123040 2:19986454-19986476 GACTGAGGACTGACCAGAGAAGG + Intronic
934947210 2:98550510-98550532 GACCCGGACCTACCCAGAGCTGG - Intronic
938408392 2:131045240-131045262 GACTCAGTACTGGCCACAGCGGG - Intronic
947154324 2:227146186-227146208 GCTTCGGACCTGACCCGAGCTGG - Intronic
948021703 2:234738604-234738626 GCCTCTGAACTGAACACAGCTGG + Intergenic
1169171793 20:3471201-3471223 GACTGGGACGTGACCAGGGCTGG + Exonic
1170955594 20:20976756-20976778 GACTGGGAAATGAGCATAGCAGG - Intergenic
1171189471 20:23149083-23149105 GTCTTGGATCTCACCAGAGCAGG - Intergenic
1176510509 21:7744676-7744698 CACTCTGAACTCACCTGAGCTGG - Intergenic
1178644622 21:34375205-34375227 CACTCTGAACTCACCTGAGCTGG - Intergenic
1182761873 22:32728957-32728979 GCCTGGGAACTGACCACAGAAGG + Intronic
950668799 3:14513050-14513072 GACTCTGGTCTGACTAGAGCAGG - Intronic
954384890 3:50238789-50238811 AACTCTGAACTTACCACAGCTGG - Intronic
954452903 3:50581237-50581259 GAGTCTGCACAGACCAGAGCTGG - Exonic
966442819 3:179965313-179965335 GACTTGGGACTGACCAAAGGAGG + Intronic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
970443392 4:16104354-16104376 GACTTGGATCTGACCAGTCCTGG + Intergenic
984028502 4:174573905-174573927 GACTTGGAATTGACCAAGGCTGG - Intergenic
990237675 5:53784985-53785007 GAGTCTGCACTGAACAGAGCAGG - Intergenic
993226173 5:85168896-85168918 GAGTGGGAAGTGACCAGGGCTGG - Intergenic
999453223 5:151694068-151694090 GATTTGGAACAGGCCAGAGCTGG - Intergenic
1001527752 5:172440790-172440812 GACTCTGAACTGGACAGACCTGG + Intronic
1002069409 5:176670443-176670465 GACTGAGAAATGGCCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1011281852 6:85685792-85685814 GACTTGTAAGTGACCAGAGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1012108847 6:95200477-95200499 AAATCGGAACTGACAAGAACAGG - Intergenic
1021430884 7:20557502-20557524 GACACTGAAATGAGCAGAGCAGG + Intergenic
1024572466 7:50734484-50734506 GACTGGGAGATGACCACAGCAGG - Intronic
1030912639 7:115270927-115270949 GACACCCCACTGACCAGAGCTGG - Intergenic
1032468070 7:132159276-132159298 TGCTTGGAATTGACCAGAGCTGG - Intronic
1034025780 7:147702213-147702235 GACTCTGAAATCACAAGAGCTGG + Intronic
1036248621 8:7142434-7142456 GACTGGGAAGGGACCATAGCAGG + Intergenic
1042175925 8:66036945-66036967 GCCGCAGAACCGACCAGAGCTGG - Intronic
1048513880 8:135087390-135087412 GACTCAGAACTAACCACTGCAGG - Intergenic
1048843859 8:138588352-138588374 GCCAGGGCACTGACCAGAGCTGG - Exonic
1049436439 8:142588277-142588299 GGCTCTGACCTGACCTGAGCAGG - Intergenic
1049454532 8:142680373-142680395 GACTCGGACCTGCCCAGCCCCGG + Intronic
1057700995 9:97363006-97363028 GACTCAGAGCTGACCACAGCAGG + Intronic
1059828522 9:118063121-118063143 GACTCAGAACTGAGAAGAGCTGG - Intergenic
1061368340 9:130184155-130184177 GACTTGGAACCAAACAGAGCTGG + Intronic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1200951700 Y:8904211-8904233 TCCTCGGAACTGGCCTGAGCTGG - Intergenic