ID: 1076858565

View in Genome Browser
Species Human (GRCh38)
Location 10:133129064-133129086
Sequence TGCCCTGAAGGCACCCGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076858565_1076858567 3 Left 1076858565 10:133129064-133129086 CCTGCACGGGTGCCTTCAGGGCA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1076858567 10:133129090-133129112 CTAAGCCGCCCTACTTTAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 28
1076858565_1076858571 16 Left 1076858565 10:133129064-133129086 CCTGCACGGGTGCCTTCAGGGCA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1076858571 10:133129103-133129125 CTTTAGCCGGCACCCAGCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076858565 Original CRISPR TGCCCTGAAGGCACCCGTGC AGG (reversed) Exonic
902063088 1:13661662-13661684 TGCCTTGGAGGAAGCCGTGCAGG - Intergenic
902359427 1:15934238-15934260 TGCCCTGAAAGGCCCCGTGAAGG + Exonic
902732482 1:18378319-18378341 TGACGTGAAGGCACCCGCCCCGG + Exonic
902933891 1:19750588-19750610 TGTCCTGAAGGCAGCCAGGCAGG - Intronic
911116427 1:94250433-94250455 TGCCTTGGGGCCACCCGTGCAGG - Intronic
913961027 1:143338299-143338321 TTCCCTGAAGGCATCAGTGCGGG - Intergenic
914055381 1:144163872-144163894 TTCCCTGAAGGCATCAGTGCGGG - Intergenic
914123765 1:144802490-144802512 TTCCCTGAAGGCATCAGTGCGGG + Intergenic
916690887 1:167189140-167189162 TGCCATGATGACACCCATGCGGG - Intergenic
922573857 1:226649160-226649182 TGACCTGAAGCCATCGGTGCAGG - Intronic
923589925 1:235309392-235309414 TGCCCGGCAGCCACCCGTCCGGG + Intronic
1063459060 10:6203941-6203963 TGCCATGGGGGCGCCCGTGCTGG + Intronic
1067029471 10:42870701-42870723 TTCCCTGAAGGCATCAGTGTGGG - Intergenic
1067217565 10:44315833-44315855 TGTCCAGAAGGCATCCGTGCTGG - Intergenic
1067918048 10:50421836-50421858 TGCCCCAAAGGGACCCATGCAGG + Intronic
1073563915 10:104519357-104519379 TGTCATGAAAGCACCAGTGCAGG - Intergenic
1075264206 10:120987121-120987143 TGCTCTTAAGTCACCCCTGCTGG - Intergenic
1075587011 10:123665688-123665710 AGCCCCGAAGGCTCCGGTGCAGG - Intergenic
1076114032 10:127882898-127882920 GGCCCTGAAGGCAGCTGGGCAGG + Intronic
1076858565 10:133129064-133129086 TGCCCTGAAGGCACCCGTGCAGG - Exonic
1077286368 11:1767778-1767800 AGCCCTGAAGGCAGCCCTGGTGG - Intergenic
1077362738 11:2147902-2147924 TGACCTGAAGGAACCCGGGGAGG - Intronic
1083920734 11:65780517-65780539 TGCCATGAAGGCAGACGGGCTGG + Exonic
1084087107 11:66859808-66859830 CGCCCTGCAGGCCCACGTGCTGG + Exonic
1089536347 11:119162697-119162719 TGCTTTGAAGGCCCCCTTGCAGG - Intergenic
1091233584 11:134003696-134003718 TGCACTGAAGCCACACCTGCTGG - Intergenic
1094034014 12:26047744-26047766 AGCCCTGAAGGGACCCAGGCAGG - Intronic
1097227683 12:57488190-57488212 GGCCCGGAAGGTACTCGTGCTGG + Exonic
1107377665 13:39821925-39821947 TGCCCTGAAGACACCCTAGGAGG - Intergenic
1113800057 13:113081591-113081613 TGCCCTGGAGTGCCCCGTGCCGG - Intronic
1118944682 14:70373355-70373377 TGACCTAAAGGGACCCGTGAGGG + Intronic
1122140874 14:99662246-99662268 CTCCCTGAAGGCCCCCATGCTGG - Intronic
1125851916 15:42912229-42912251 GGGCCTGAAGGCACCCCTTCAGG + Intronic
1127994362 15:64144471-64144493 TGCCCCGGAGGCTCCTGTGCAGG - Intronic
1128986036 15:72222344-72222366 TGACCTGAAGCCTCCCTTGCAGG + Intronic
1129489469 15:75909405-75909427 GGCCCTGAAGGAAGCCTTGCTGG + Intronic
1132547019 16:537900-537922 GGCCCTGCAGCCACCAGTGCTGG - Intronic
1132826782 16:1909189-1909211 TTCACAGAGGGCACCCGTGCAGG + Intergenic
1132873880 16:2127415-2127437 TGCGCTGAAGGCACCGAGGCTGG + Intronic
1133116893 16:3582602-3582624 TGCCTCGCAGGCAGCCGTGCAGG - Exonic
1134552967 16:15146589-15146611 TGCGCTGAAGGCACCGAGGCTGG + Intergenic
1135714240 16:24747423-24747445 TGCCCTGAAGGCTACTTTGCAGG - Intronic
1136472320 16:30489307-30489329 TGACCTGAAGGCAGACCTGCAGG + Exonic
1137488863 16:48914105-48914127 AGCCATGAAGCCACCCATGCAGG + Intergenic
1140722980 16:77788078-77788100 TGCCCTGAAGAGTCCAGTGCAGG - Intergenic
1142252273 16:88997477-88997499 TCACCTGCAGGCACCAGTGCAGG - Intergenic
1143320915 17:6068532-6068554 TGCTCAGAAGGGACCCGTACTGG + Intronic
1144837985 17:18167541-18167563 TGCCAGGCAGGCACGCGTGCAGG - Intronic
1152829896 17:82490814-82490836 TGCCGTGAAGCCGCCCCTGCAGG + Intergenic
1153541396 18:6159632-6159654 TGCCCTGGAGCCTCCCGTGCAGG - Intronic
1156073195 18:33237810-33237832 TGCCCTGAAGACACACCTGAAGG + Intronic
1157575257 18:48739207-48739229 TGTCCTGAAGGCTCCTATGCCGG - Intronic
1161765394 19:6205093-6205115 TGCCATGATGGCACCAATGCTGG - Intergenic
1163609458 19:18293357-18293379 TGGCCTGGAGGCACCCAGGCAGG + Intergenic
1165098510 19:33424124-33424146 TGCCCTGAAAGCCCCAGTGAGGG - Intronic
1165255503 19:34575399-34575421 TGCCCTGAAGGCATGCTTGGGGG - Intergenic
1166456846 19:42948972-42948994 TGCCCTGACTCCACCCGGGCTGG - Intronic
1166466797 19:43039841-43039863 TGCCCTGACTCCACCCGGGCTGG - Intronic
1166472934 19:43095919-43095941 TGCCCTGACTCCACCCGGGCTGG - Intronic
1168368192 19:55807629-55807651 TGCCTTGAAGGCAGCCATGATGG + Intronic
1202694864 1_KI270712v1_random:116549-116571 TTCCCTGAAGGCATCAGTGCGGG - Intergenic
925921290 2:8639533-8639555 TCTCCTGAAGTCACCTGTGCAGG + Intergenic
927890014 2:26742405-26742427 TGCCCTGAAGGCAGGGCTGCTGG - Intergenic
928802908 2:35115753-35115775 TGCCCTGTAGCCACCAGAGCTGG - Intergenic
929453435 2:42050921-42050943 TGCCCTGAAGCCTCCTGGGCAGG - Intronic
931875732 2:66509751-66509773 TGCCCTCAAGGCACGCTTTCAGG + Intronic
932732669 2:74232101-74232123 TGCCCTGATGGCCCTCCTGCGGG - Intronic
934276034 2:91573597-91573619 TTCCCTGAAGGCATCAGTGCGGG - Intergenic
934517550 2:94998315-94998337 TCCCTTGAAGGCACCTGCGCAGG + Intergenic
935458500 2:103299690-103299712 TGCCCAGAAGGGAACTGTGCAGG - Intergenic
935605553 2:104969419-104969441 TGACGGGAAGGCACCCGTGGTGG - Intergenic
941680789 2:168396525-168396547 TCCCCTGAAGGCACATGTTCTGG - Intergenic
943517555 2:188906957-188906979 TGCCATGAGGCCACCAGTGCAGG + Intergenic
947087029 2:226465097-226465119 TCCCTTGAAGGAACCAGTGCAGG - Intergenic
1168850593 20:974022-974044 TGCCCTAAAGTCACGGGTGCAGG + Intronic
1169497521 20:6129500-6129522 TGCCCTAGTGGCTCCCGTGCTGG + Intergenic
1169990584 20:11498545-11498567 TATCCAGAAGGCACCAGTGCTGG - Intergenic
1171356241 20:24547593-24547615 TGCCCTGAGGGCACCCCCACAGG - Intronic
1172936768 20:38626090-38626112 TGCCCTGGAGGCATCTGTTCTGG + Intronic
1173642107 20:44610553-44610575 TGCCCAGAAGGCACCCAGGGTGG - Intronic
1173736243 20:45363510-45363532 TGCCCTGCAGGGACACGAGCCGG - Exonic
1173961147 20:47073613-47073635 GGCCCTGATGGCACCTGTCCTGG - Intronic
1175960952 20:62636150-62636172 TGCCCTGAAGGCTGCCGAGGCGG + Intergenic
1176239806 20:64070661-64070683 TGCCCTGAAGACACCGGGCCCGG - Intronic
1183202604 22:36396194-36396216 TGCTCTGAAGACATCCATGCAGG + Intergenic
1183629802 22:39026136-39026158 TGCCCTGTGGGCACCCGGCCCGG - Intronic
1183633244 22:39045995-39046017 TGCCCTGTGGGCACCCGGCCCGG - Intronic
1184130752 22:42515190-42515212 GGCCCTGAAGGGCCCCCTGCTGG - Exonic
1184140931 22:42577020-42577042 GGCCCTGAAGGGCCCCCTGCTGG - Intergenic
1184236110 22:43183825-43183847 TGCCCAGAAGCCCCCCTTGCCGG - Intronic
1184798954 22:46748558-46748580 TGCCCTGAAAGCACACTTGGGGG + Intergenic
950534594 3:13571669-13571691 TGCCCTGAAGGAACCAGGACAGG - Intronic
951580974 3:24162061-24162083 TGCTCTGAAGGCAGCTTTGCAGG - Intronic
957193733 3:77040971-77040993 TGCCCCCAAGGAGCCCGTGCCGG - Intronic
957377571 3:79378360-79378382 TGCCAGGAAGGCAAACGTGCTGG - Intronic
959804240 3:110531826-110531848 TGCACTGAAGACACCCGTTTGGG - Intergenic
961173568 3:124816162-124816184 TGTCCTGAAGGCAACCGGGTGGG - Intronic
969348971 4:6587138-6587160 CGACCTGAAGGCAGCCATGCAGG + Exonic
973716849 4:53685289-53685311 TGTGCTGATGGCACCCTTGCTGG - Intronic
979556479 4:122053334-122053356 TGGCCTGCAGTCAGCCGTGCTGG - Intergenic
985605729 5:857233-857255 TGCGCTGCAGGCCCCGGTGCTGG - Intronic
986032624 5:3908559-3908581 TGCTCTGAAGGCTCCGGTGGAGG + Intergenic
987646667 5:20681189-20681211 CTGCCTGAAGGCACCCCTGCAGG + Intergenic
993905610 5:93620669-93620691 TGCCCTGAAGGAGACCGCGCGGG - Exonic
995123235 5:108557346-108557368 TACCCAGTAGGCACCCGTACAGG - Intergenic
998716393 5:144889500-144889522 TGCCCTGTAGCCACCAGAGCTGG - Intergenic
999576794 5:152987748-152987770 TGCCCTGAAGGCACCTAGGAAGG + Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1006980298 6:38142356-38142378 CTCCCTGAAGGCACCTTTGCAGG - Intronic
1022582006 7:31564826-31564848 TGCCCTGAAGACACCTGGGCCGG + Intronic
1024253634 7:47523986-47524008 TGCACTGCAGGCACCCAGGCTGG + Intronic
1024580123 7:50793942-50793964 TGGGCTGAAGGCACCCGGCCTGG + Intergenic
1026641596 7:72131100-72131122 TGCCCTTAAAGCACTCGTGAAGG + Intronic
1027189159 7:75987875-75987897 AGCCCTGGAGGCACCCGTGGTGG - Intronic
1034859761 7:154585051-154585073 TGCCCTGAAGGAAGCAGAGCAGG - Intronic
1036627364 8:10483218-10483240 TGCTCTGAAAGAACCTGTGCAGG + Intergenic
1038271874 8:26081928-26081950 TTCCCTGAAGGCACCTGTGGAGG - Intergenic
1041755070 8:61304728-61304750 TGCCATGAATGCCCCAGTGCTGG + Intronic
1046696445 8:117345154-117345176 TGCCCCAAAGGGACCCATGCAGG - Intergenic
1053294785 9:36905098-36905120 TGCACTGAAGGCACATGGGCAGG + Intronic
1056788782 9:89611836-89611858 TGCTCTGAAGGCAGCTCTGCTGG - Intergenic
1060540553 9:124427302-124427324 TGCTCTGAAGGCACTCCTACCGG - Intergenic
1062145936 9:134989686-134989708 ACCCCTGAGGGCACCGGTGCAGG + Intergenic
1062612807 9:137382665-137382687 TGGCCTGAGGTCACCCCTGCAGG - Intronic
1186481559 X:9899937-9899959 TGTGCAGAGGGCACCCGTGCTGG + Intronic
1188438470 X:30189834-30189856 TGCCCTGAAGGGACCTCTGATGG + Intergenic
1191694605 X:63977246-63977268 TGCCCTGTAGCCACCAGAGCTGG - Intergenic
1195128593 X:101832584-101832606 TGTCCTGAAGGCACCTGGGGTGG + Intronic
1195177599 X:102326254-102326276 TGTCCTGAAGGCACCTGGGGTGG - Exonic
1195181265 X:102360839-102360861 TGTCCTGAAGGCACCTGGGGTGG + Exonic
1195203343 X:102571205-102571227 TGTCCTGAAGGCACCTGGGGTGG - Intergenic
1199308686 X:146297565-146297587 TGCCCTGTAGGCACCACAGCTGG + Intergenic