ID: 1076861225

View in Genome Browser
Species Human (GRCh38)
Location 10:133139315-133139337
Sequence GGTCCCTGTGTGCGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076861218_1076861225 2 Left 1076861218 10:133139290-133139312 CCCTGTGGGGGGGGTCTGGTCTC No data
Right 1076861225 10:133139315-133139337 GGTCCCTGTGTGCGGGTGGCTGG No data
1076861219_1076861225 1 Left 1076861219 10:133139291-133139313 CCTGTGGGGGGGGTCTGGTCTCT No data
Right 1076861225 10:133139315-133139337 GGTCCCTGTGTGCGGGTGGCTGG No data
1076861207_1076861225 28 Left 1076861207 10:133139264-133139286 CCTGTTGGGGGGTCTGGTCTCTG No data
Right 1076861225 10:133139315-133139337 GGTCCCTGTGTGCGGGTGGCTGG No data
1076861206_1076861225 29 Left 1076861206 10:133139263-133139285 CCCTGTTGGGGGGTCTGGTCTCT No data
Right 1076861225 10:133139315-133139337 GGTCCCTGTGTGCGGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076861225 Original CRISPR GGTCCCTGTGTGCGGGTGGC TGG Intergenic