ID: 1076863750

View in Genome Browser
Species Human (GRCh38)
Location 10:133157133-133157155
Sequence CTGTGGCTCTGGCGGAAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076863750_1076863756 5 Left 1076863750 10:133157133-133157155 CCGTGTTTCCGCCAGAGCCACAG No data
Right 1076863756 10:133157161-133157183 CTCCCCGCAGAAGCCAGTCGTGG No data
1076863750_1076863760 12 Left 1076863750 10:133157133-133157155 CCGTGTTTCCGCCAGAGCCACAG No data
Right 1076863760 10:133157168-133157190 CAGAAGCCAGTCGTGGTCCACGG No data
1076863750_1076863762 26 Left 1076863750 10:133157133-133157155 CCGTGTTTCCGCCAGAGCCACAG No data
Right 1076863762 10:133157182-133157204 GGTCCACGGTTCCCGCGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076863750 Original CRISPR CTGTGGCTCTGGCGGAAACA CGG (reversed) Intergenic
No off target data available for this crispr