ID: 1076864058

View in Genome Browser
Species Human (GRCh38)
Location 10:133158853-133158875
Sequence CCGGGCTGACGTGACCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076864058_1076864061 -9 Left 1076864058 10:133158853-133158875 CCTTTGGGGTCACGTCAGCCCGG No data
Right 1076864061 10:133158867-133158889 TCAGCCCGGCGTTCCCCCGGAGG No data
1076864058_1076864064 2 Left 1076864058 10:133158853-133158875 CCTTTGGGGTCACGTCAGCCCGG No data
Right 1076864064 10:133158878-133158900 TTCCCCCGGAGGCACAAGTCTGG No data
1076864058_1076864072 24 Left 1076864058 10:133158853-133158875 CCTTTGGGGTCACGTCAGCCCGG No data
Right 1076864072 10:133158900-133158922 GGTGGCAGCTGAGAGGCGTCAGG No data
1076864058_1076864069 6 Left 1076864058 10:133158853-133158875 CCTTTGGGGTCACGTCAGCCCGG No data
Right 1076864069 10:133158882-133158904 CCCGGAGGCACAAGTCTGGGTGG No data
1076864058_1076864065 3 Left 1076864058 10:133158853-133158875 CCTTTGGGGTCACGTCAGCCCGG No data
Right 1076864065 10:133158879-133158901 TCCCCCGGAGGCACAAGTCTGGG No data
1076864058_1076864073 25 Left 1076864058 10:133158853-133158875 CCTTTGGGGTCACGTCAGCCCGG No data
Right 1076864073 10:133158901-133158923 GTGGCAGCTGAGAGGCGTCAGGG No data
1076864058_1076864071 17 Left 1076864058 10:133158853-133158875 CCTTTGGGGTCACGTCAGCCCGG No data
Right 1076864071 10:133158893-133158915 AAGTCTGGGTGGCAGCTGAGAGG No data
1076864058_1076864074 26 Left 1076864058 10:133158853-133158875 CCTTTGGGGTCACGTCAGCCCGG No data
Right 1076864074 10:133158902-133158924 TGGCAGCTGAGAGGCGTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076864058 Original CRISPR CCGGGCTGACGTGACCCCAA AGG (reversed) Intergenic
No off target data available for this crispr