ID: 1076864954

View in Genome Browser
Species Human (GRCh38)
Location 10:133161924-133161946
Sequence GCTCCAAGTGGGCTCGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076864954 Original CRISPR GCTCCAAGTGGGCTCGCGCC TGG (reversed) Intronic
912934046 1:113987322-113987344 GCTCCAAGTGGGCTATGCCCAGG - Intergenic
915277846 1:154801856-154801878 GCACCAAGTCGGGGCGCGCCAGG + Intronic
916574469 1:166055120-166055142 GCTCCAAGGGGGCCCACACCTGG + Intergenic
1076029665 10:127146800-127146822 ACTCCAAGTGGGCTCCGGACAGG + Intronic
1076721833 10:132396494-132396516 GCGACAAGCGGGCGCGCGCCCGG - Intergenic
1076864954 10:133161924-133161946 GCTCCAAGTGGGCTCGCGCCTGG - Intronic
1077306059 11:1869137-1869159 GCTCCAAGTGGGCTGAGACCCGG + Intronic
1083767703 11:64849793-64849815 TGGCCAAGTGGGCTCGGGCCTGG - Intergenic
1085385369 11:76154621-76154643 GCGCCAAGTGGGGTCCCTCCTGG + Intergenic
1085514182 11:77102787-77102809 GACCCAAGTGGGCTGGAGCCTGG - Intronic
1091057257 11:132430547-132430569 GCTCCAAGAGGGCTCAGGCTTGG + Intronic
1128481744 15:68045818-68045840 GCTCCAAGTGTGCACACACCTGG - Intergenic
1137928284 16:52562556-52562578 GCTTGAAGTGGGCTAGCTCCGGG - Intergenic
1148745214 17:49914239-49914261 GCTGAAAGTGGCCTCCCGCCTGG - Intergenic
1149662810 17:58344342-58344364 GTGCCAAGTGGGCTCTCCCCGGG - Intergenic
1152195672 17:78916773-78916795 GCTCCACCTGGGCTCAAGCCTGG + Intronic
1154012671 18:10589196-10589218 GCTCCAGGTGGCCCCGGGCCGGG + Intergenic
1161359377 19:3838706-3838728 GCTCCAGGAGGGCTCGTCCCAGG - Intronic
1164581948 19:29440074-29440096 GTTCCAGGTGGGCTTGGGCCTGG + Intergenic
927158526 2:20236362-20236384 GCTCCTGGTGGGCTCTTGCCAGG - Intergenic
927431323 2:23028499-23028521 GCTCCCAGTGGGCTGGCTCTAGG - Intergenic
932462822 2:71894347-71894369 GCTCCAAGTGGCCTGGCCCCAGG + Intergenic
937122639 2:119451526-119451548 GCTGCGAGTGGGCTCAGGCCTGG - Intronic
937125989 2:119475333-119475355 GCTCCCTGTGGGCTCGCCCAGGG + Intronic
941645909 2:168041053-168041075 GCTCCAAGTGGGCAAGGACCAGG - Intronic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
946374772 2:219301507-219301529 ACTCCAAGTGGTCTCGAGGCAGG + Intronic
1174380764 20:50153948-50153970 GCTCCCAGTGGGCTGGAGCCGGG - Intergenic
1179571505 21:42281318-42281340 GCTCCAGGTGGGCTGTCCCCAGG + Intronic
1181553218 22:23652793-23652815 GCTCAAAGTGGCCCCGCGCAAGG + Intergenic
1183276021 22:36898695-36898717 GCTCCAAGTAGGCTAACCCCAGG + Intergenic
1183394276 22:37562325-37562347 GCTCCAAGTGTCCTGGTGCCAGG - Intronic
1183689945 22:39382791-39382813 CCTCCAAGAGGGCTCACCCCGGG + Exonic
954008198 3:47610158-47610180 GCTCCAAGTGGGGCCAGGCCAGG + Exonic
967160702 3:186735274-186735296 GCTCCAGCTGGTCTCGCTCCTGG - Intronic
972670822 4:41213337-41213359 GCTCCAACTGGGCTCTCGGAGGG - Intronic
980985526 4:139691097-139691119 GTTCAAAGAGGGCTCTCGCCAGG + Intronic
984095479 4:175428006-175428028 GCTCCAGGTGGGCGCGGGCCCGG + Intergenic
985312780 4:188619964-188619986 GCTCCAAGAGGGATCTCTCCTGG - Intergenic
997326508 5:133026352-133026374 GCTCCCGGGGGGCTCGGGCCCGG - Intronic
1002564264 5:180101027-180101049 GCTGCCAGTGGGCTCGGGGCTGG + Exonic
1018924738 6:168198312-168198334 GCTCCAAGTGGGCTCCTCCCTGG - Intergenic
1027887107 7:83922578-83922600 GCTTTAAGTGGGCTGGTGCCTGG + Intergenic
1032474428 7:132202601-132202623 GCTCCAAATGGGCAGGCTCCAGG - Intronic
1047417879 8:124680458-124680480 CCTCCAAGTGTGCTCTCCCCTGG - Intronic
1056766470 9:89447428-89447450 GCTCCAAGTGGGCTTCCACCTGG - Intronic
1060042149 9:120308869-120308891 GCTCCAAGTGTGCTGGGGGCAGG + Intergenic
1060140112 9:121202049-121202071 GCCCCACGGGCGCTCGCGCCCGG + Intronic
1061955009 9:133956800-133956822 CCTCCCACTGGGCTCCCGCCTGG - Intronic
1188305151 X:28552664-28552686 GCTCCATGTGGGCTAGAACCAGG + Intergenic
1199973587 X:152878063-152878085 GCTCCAAGAGGGCTCTGGGCAGG - Intergenic
1200235681 X:154466763-154466785 GCTCCAGGTGGGCTCAAGGCGGG - Exonic