ID: 1076865257

View in Genome Browser
Species Human (GRCh38)
Location 10:133163438-133163460
Sequence GTCCATATGACATCTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865250_1076865257 9 Left 1076865250 10:133163406-133163428 CCCAGTAAAGAAGAGGACGTCCC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1076865257 10:133163438-133163460 GTCCATATGACATCTGTGCCAGG No data
1076865251_1076865257 8 Left 1076865251 10:133163407-133163429 CCAGTAAAGAAGAGGACGTCCCC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1076865257 10:133163438-133163460 GTCCATATGACATCTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865257 Original CRISPR GTCCATATGACATCTGTGCC AGG Intronic
No off target data available for this crispr