ID: 1076865562

View in Genome Browser
Species Human (GRCh38)
Location 10:133164716-133164738
Sequence CCTGTAGTCACCTCCAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865562_1076865573 29 Left 1076865562 10:133164716-133164738 CCCCTTCTGGAGGTGACTACAGG 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG No data
1076865562_1076865566 -7 Left 1076865562 10:133164716-133164738 CCCCTTCTGGAGGTGACTACAGG 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1076865566 10:133164732-133164754 CTACAGGACGCCCACAGCTCAGG No data
1076865562_1076865572 28 Left 1076865562 10:133164716-133164738 CCCCTTCTGGAGGTGACTACAGG 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1076865572 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data
1076865562_1076865567 1 Left 1076865562 10:133164716-133164738 CCCCTTCTGGAGGTGACTACAGG 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1076865567 10:133164740-133164762 CGCCCACAGCTCAGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865562 Original CRISPR CCTGTAGTCACCTCCAGAAG GGG (reversed) Intronic
900391438 1:2435664-2435686 CCTGTTGTGATCTCCAGGAGGGG + Intronic
902374696 1:16024880-16024902 CGTGGACTCACCTCCAGAGGAGG - Exonic
902637393 1:17743528-17743550 CCTCTCCTCCCCTCCAGAAGTGG - Intergenic
902995653 1:20222771-20222793 CCAGTTGTCATCTACAGAAGAGG + Intergenic
906215156 1:44034256-44034278 CCTGCAGTGACCACCAGAAGTGG - Intergenic
907465641 1:54634377-54634399 CCTGTACTCAGCTCAAAAAGCGG + Intronic
908438521 1:64130642-64130664 CTTGAAGTCTCCTCCAGAAGAGG + Intronic
910264799 1:85327213-85327235 CCTGTAGTCACCTCCTCAGGAGG + Intronic
917225009 1:172772286-172772308 TCTCTAGTCTCCTCCAGAAAAGG - Intergenic
917238002 1:172915520-172915542 CCTGTTGTCACCATCAGAACAGG - Intergenic
918012332 1:180598963-180598985 CCTGAAGGCAACTCCAGGAGAGG + Intergenic
920062498 1:203237215-203237237 TCTGCTGTCACCTCCTGAAGAGG + Intronic
920851236 1:209629407-209629429 ACTGTATACACCTGCAGAAGAGG - Intronic
921622405 1:217340417-217340439 CCTGTAGTCCCCTCCTCAGGAGG - Intergenic
922370581 1:224906839-224906861 TCTGAAGTCACCTGCAGCAGTGG - Intronic
1064043523 10:11989850-11989872 CCTTGAGTCACCTCCTGAAAGGG + Intronic
1064233441 10:13550683-13550705 ACTGTAGGCACCTCAGGAAGGGG - Intergenic
1065306416 10:24373360-24373382 TCTGGACTTACCTCCAGAAGGGG - Intronic
1070160759 10:73865522-73865544 CCTGTAGTCACATCCAGGGCTGG + Intronic
1070839113 10:79470904-79470926 CCTGTAGTCAGCTACTCAAGAGG - Intergenic
1075379009 10:122003569-122003591 CCTGTGGTCACTTCCGGATGTGG + Intronic
1076865562 10:133164716-133164738 CCTGTAGTCACCTCCAGAAGGGG - Intronic
1077289254 11:1781337-1781359 GCGGGAGCCACCTCCAGAAGGGG - Intergenic
1077304722 11:1863976-1863998 CTTGTTGTCACCTCCAGAGAAGG - Intronic
1084317847 11:68355589-68355611 CCTGTGGTCACCTCCAAACAGGG + Intronic
1085739317 11:79065363-79065385 GCTGAGGTCACCTCCAGCAGAGG - Intronic
1091706502 12:2697079-2697101 GCTGGAGACACCTCCTGAAGGGG - Intronic
1092003441 12:5049492-5049514 CTTCAAGTCCCCTCCAGAAGTGG + Intergenic
1093744299 12:22722195-22722217 TATGTAGTCACCACCAGAAAGGG - Intergenic
1096258264 12:50075609-50075631 CCTCCATTGACCTCCAGAAGAGG - Intronic
1101527840 12:105547913-105547935 CCTGAAGTCAGGTCCAGGAGTGG + Intergenic
1101968283 12:109295447-109295469 CCTAGGGTCACCTCCAGAGGAGG + Intronic
1103145325 12:118590431-118590453 CCTGTAGTCAGCAGCAGAGGTGG + Intergenic
1105368860 13:19785453-19785475 CCTGCAGCCCTCTCCAGAAGTGG + Intergenic
1107438590 13:40403895-40403917 CCTGGAGCCACCTCCAACAGAGG + Intergenic
1107690365 13:42947493-42947515 CCTGATGTCACTTCCAGAGGTGG + Intronic
1110640025 13:77813061-77813083 TCTGTAGTCAGCACAAGAAGAGG - Intergenic
1110937878 13:81316245-81316267 CCTGTTGTCACCTCCAGGGGAGG + Intergenic
1116773427 14:49152891-49152913 CCAGAAGTCCCCTCCAGAACAGG + Intergenic
1118859657 14:69652738-69652760 CCTGGAGTCACCTTCAAAAATGG - Intronic
1121264067 14:92587703-92587725 CTTGCAGTCACTTCCAAAAGAGG - Intronic
1121327298 14:93028666-93028688 CCTGCAGGCACCTCCCCAAGCGG + Intronic
1122049189 14:99043500-99043522 GCTGTCGGCCCCTCCAGAAGTGG - Intergenic
1122642140 14:103166167-103166189 CCCGGAGGCACCTCCAGCAGGGG + Intergenic
1125983256 15:44023266-44023288 CCTGTAACAACCTCCAGATGGGG - Intronic
1127574804 15:60280818-60280840 CCTGTAGTCATCTGCAGCAAAGG + Intergenic
1128086208 15:64888468-64888490 TCTGGGGTCAGCTCCAGAAGAGG - Intronic
1129452316 15:75658006-75658028 CCTGTAGCCCCCTCCTGCAGGGG - Exonic
1129452668 15:75659566-75659588 CATGTAGCCATCTGCAGAAGGGG + Exonic
1129744464 15:78008311-78008333 CCTGCAGTCACCTCCTGCAGTGG - Intronic
1129850483 15:78790945-78790967 CCTGTAGGAACCTCCTGCAGAGG + Intronic
1133036586 16:3036939-3036961 CCTGGAGCCGCCTCCGGAAGAGG - Intergenic
1135056317 16:19234758-19234780 CCTGTGGGCCCATCCAGAAGTGG + Intronic
1137605520 16:49784275-49784297 CCTGTAGTCCCCACTACAAGGGG + Intronic
1140685803 16:77433457-77433479 CCCTTACTCACCTCCTGAAGTGG - Intronic
1141112244 16:81279395-81279417 CCCGTAGTCACCTCCAGTAGTGG + Intronic
1142233105 16:88909034-88909056 CCTGTGGTCAGCTCCAGGAAGGG - Intronic
1142894885 17:2967776-2967798 ACAGTAGTCACCGCCAGCAGGGG - Intronic
1145268504 17:21391974-21391996 CCTGTAGCCACTTTCAGATGAGG - Intronic
1146689352 17:34862483-34862505 CCTGTAGTTACCTACACCAGGGG + Intergenic
1153538490 18:6129201-6129223 CCTCTAGTTCCTTCCAGAAGGGG + Intronic
1156520576 18:37719505-37719527 CCTGCAGGGAACTCCAGAAGAGG - Intergenic
1157927204 18:51779522-51779544 CCTGTAGTGACCTCCCTCAGAGG - Intergenic
1158237290 18:55331291-55331313 TCTGTAGTCACTTCCAGATAAGG + Intronic
1159829310 18:73254663-73254685 CCTGAAGTCCTCACCAGAAGCGG - Intronic
1160293749 18:77618959-77618981 CCTGAAGTCAGATCCAAAAGGGG + Intergenic
1160841642 19:1149071-1149093 CCTGGTGTCACCTCCACAGGAGG + Intronic
1162942629 19:14022378-14022400 CCTGTAGTCCCCTACACAGGAGG - Intergenic
1166380916 19:42354776-42354798 CCTGAACTCACCACCTGAAGTGG + Intronic
1166516112 19:43448291-43448313 GCTGGACTCACCTCCAGAGGTGG + Intergenic
1167609798 19:50501620-50501642 CCGTTAGGCACCTGCAGAAGTGG - Intergenic
1167680493 19:50917187-50917209 CCTGGGATCTCCTCCAGAAGTGG + Intergenic
1167862612 19:52297438-52297460 CATGTAGTCACCTCCTGTCGCGG + Intronic
1168137245 19:54359985-54360007 CCTGTAATCCCCTCCAGCTGAGG + Intronic
1168160832 19:54509100-54509122 CCTGTAATCCCCTCCAGCTGAGG - Intronic
925062673 2:905231-905253 TCTGTGGTCAAGTCCAGAAGAGG + Intergenic
925438890 2:3867099-3867121 CCTGTAGCCCCATCCAGAGGTGG + Intergenic
926942882 2:18156512-18156534 CCTGAAGTCAGTTCCAGAAGGGG - Intronic
927014427 2:18943198-18943220 ACTGCTGCCACCTCCAGAAGTGG + Intergenic
927605952 2:24486967-24486989 GCTGTAGTCACTTGAAGAAGGGG + Intergenic
930781936 2:55232097-55232119 CCTTCACTCACTTCCAGAAGCGG - Intronic
933249640 2:80014891-80014913 CCTTTAATCACCTCAAGATGGGG + Intronic
933322341 2:80792601-80792623 CCTGTTGTCTCTTCCAGAATTGG - Intergenic
936597094 2:113858482-113858504 TCTGCAGTTACCCCCAGAAGTGG - Intergenic
938041086 2:128076698-128076720 CCTGTGGCCACACCCAGAAGCGG - Intergenic
939496108 2:142930373-142930395 CCTCTAGTCATCTCCTGAAATGG - Intronic
942499055 2:176569017-176569039 GCTGTAGTAAGCTTCAGAAGAGG + Intergenic
944075243 2:195722363-195722385 CTTTCTGTCACCTCCAGAAGAGG - Intronic
945296915 2:208179565-208179587 CCTTTGGATACCTCCAGAAGAGG - Intronic
947707770 2:232290479-232290501 AATGGAGTCACCTTCAGAAGAGG + Intronic
948880722 2:240855965-240855987 CCTGCAGCCACCTCCAGAAAGGG + Intergenic
1170015908 20:11781895-11781917 CCTGTAGAAATCTTCAGAAGAGG + Intergenic
1172658515 20:36550763-36550785 CCTGGTATCAACTCCAGAAGGGG + Exonic
1173886621 20:46464855-46464877 CCTGTATTCATTTCCACAAGCGG + Intergenic
1174914034 20:54636527-54636549 CCTGTGGTCCCACCCAGAAGTGG + Intronic
1175229519 20:57464926-57464948 CCTGTGTTCATCTGCAGAAGGGG + Intergenic
1176386251 21:6139849-6139871 CCTGTGGTCACCTCCCCCAGAGG - Intergenic
1177281119 21:18984416-18984438 CCTGTGGTCCCAACCAGAAGTGG + Intergenic
1177673624 21:24267755-24267777 TATGTATTCACCTCCTGAAGGGG + Intergenic
1179231923 21:39511798-39511820 CCTGTAGCTACCTGGAGAAGTGG - Exonic
1179547021 21:42119285-42119307 CCTCTGATCACCTCCAGCAGAGG - Exonic
1179737222 21:43398403-43398425 CCTGTGGTCACCTCCCCCAGAGG + Intergenic
1180814465 22:18780993-18781015 CCTGGAGTCAGCTCCAGACAGGG + Intergenic
1181003135 22:19997344-19997366 CCTTTAGGGACCTCCAGCAGTGG - Intronic
1181021343 22:20104996-20105018 CCTGCAGACCCCTCCAGAACAGG + Intronic
1181200653 22:21215329-21215351 CCTGGAGTCAGCTCCAGACAGGG + Intronic
1181799190 22:25333241-25333263 CCTCAAGTGACTTCCAGAAGAGG - Intergenic
1183094098 22:35541885-35541907 GCTGCAGCCAGCTCCAGAAGAGG - Intronic
1184434869 22:44465170-44465192 GCTGGACTCAACTCCAGAAGTGG - Intergenic
1184527936 22:45036530-45036552 CATGTAGTCACTTCTAGCAGAGG + Intergenic
1185375818 22:50482189-50482211 CCAGCAGACACCCCCAGAAGAGG - Intronic
1203226264 22_KI270731v1_random:80106-80128 CCTGGAGTCAGCTCCAGACAGGG - Intergenic
1203264564 22_KI270734v1_random:6680-6702 CCTGGAGTCAGCTCCAGACAGGG + Intergenic
949573393 3:5315032-5315054 ACTGTAATCACCTCCATCAGAGG + Intergenic
951942442 3:28094380-28094402 CCTGTGGTCCCACCCAGAAGTGG - Intergenic
955794882 3:62625038-62625060 GCTGTAGTCAACCCAAGAAGAGG - Intronic
960745432 3:120882693-120882715 TCTGTAGTCATCTCCAGGAGGGG - Intergenic
962122851 3:132581914-132581936 CCTGTAGTCAACTACAGTTGTGG + Intronic
962244923 3:133784557-133784579 CCTGCTGTCACTTCCAGAGGTGG - Intronic
966677141 3:182601824-182601846 CCTGTAGTCATGGCCAGCAGGGG + Intergenic
967109652 3:186282297-186282319 CCAGCAGTCACCCCCAGCAGTGG + Intronic
967587753 3:191235417-191235439 CCTTTTGTCTCCTCCAGAACTGG + Intronic
968085138 3:195870790-195870812 ACTGCAGACACCTCCAGGAGAGG - Intronic
969581956 4:8070982-8071004 CCTGTCAACACCTCCTGAAGAGG - Intronic
979755636 4:124337319-124337341 CCAGAAGTCACATACAGAAGTGG - Intergenic
999264382 5:150256881-150256903 CCTGGAGACTCCTCCAGATGAGG - Intronic
999323981 5:150631736-150631758 CATTTAGCCACCTCAAGAAGTGG - Intronic
1002091101 5:176806987-176807009 CCTGAAGGCATCTCCTGAAGGGG - Intergenic
1003369689 6:5512264-5512286 CCTGAAGTCAATTCCAGAACTGG - Intronic
1005753378 6:28904055-28904077 CCTGAATTCACCTCCTCAAGGGG + Exonic
1007321410 6:41031122-41031144 CCTGTTGTCACTTGGAGAAGAGG - Intronic
1007694045 6:43720310-43720332 CTTGAAGTCACCTCCAGCAAGGG - Intergenic
1007729339 6:43936389-43936411 CCTGTCTTCCCTTCCAGAAGCGG - Intergenic
1012401975 6:98848470-98848492 CCTATAGTCCCCTCCCCAAGCGG + Intergenic
1013007154 6:106084365-106084387 CCTGCACTCACCTTCAGAGGTGG - Intergenic
1016887088 6:148968653-148968675 ACTGTTGTCATCTCCAGATGAGG + Intronic
1018964358 6:168473106-168473128 ACTGTAGTCACCTTCAGGGGTGG - Intronic
1019606254 7:1911725-1911747 TCTGGCGTCACCTCCAGATGAGG + Intronic
1030615887 7:111738004-111738026 TCTGTAGCCACATCCGGAAGTGG - Intronic
1032412311 7:131705126-131705148 CCTGTAGTCACAGCTAGTAGGGG + Intergenic
1034709966 7:153182729-153182751 CCTTTGGCCACTTCCAGAAGTGG - Intergenic
1036235928 8:7039441-7039463 ACTGTAGTCACCTGGAGGAGAGG + Intergenic
1037551407 8:19975364-19975386 CTTGTAGAAACCTACAGAAGTGG - Intergenic
1041654040 8:60330742-60330764 CATGGAGTCAGCTCTAGAAGTGG + Intergenic
1044014808 8:87038449-87038471 CCTGTGGCCCCATCCAGAAGAGG - Intronic
1046120379 8:109838956-109838978 TCTGGAGGAACCTCCAGAAGAGG - Intergenic
1047403933 8:124569254-124569276 CCTGTCTTAAACTCCAGAAGTGG - Intronic
1049122734 8:140754142-140754164 CCTTTCTTCACCTCCAGAGGAGG + Intronic
1049687366 8:143944307-143944329 CCTGCTGTCCCCACCAGAAGAGG + Intronic
1054295441 9:63329417-63329439 TCTGTAGTTACCTCCAGCATGGG - Intergenic
1055143228 9:72900263-72900285 CTTGTAGTGACTTGCAGAAGTGG - Intergenic
1056752235 9:89360691-89360713 GCTGAAGTCACCTGCAGCAGTGG - Intergenic
1061701953 9:132422785-132422807 CCTGTTGTCACCTTCAGTAGAGG - Intronic
1185999594 X:4993641-4993663 CCTTCAGTCTCTTCCAGAAGAGG + Intergenic
1189147326 X:38668378-38668400 TGTGAAGCCACCTCCAGAAGAGG - Intronic
1189598999 X:42601438-42601460 CCTCTTGTCACCTCCACAGGAGG - Intergenic
1192486746 X:71533881-71533903 CCACAAGTCACCTCGAGAAGAGG + Intronic
1194593946 X:95835613-95835635 GCTGCAGTCAACTCAAGAAGAGG - Intergenic
1201573595 Y:15438914-15438936 CCTGCAGTCCCCTGAAGAAGAGG + Intergenic
1202181015 Y:22140028-22140050 CCTGTAGTAGCATCAAGAAGAGG - Intergenic
1202210345 Y:22446372-22446394 CCTGTAGTAGCATCAAGAAGAGG + Intergenic