ID: 1076865564

View in Genome Browser
Species Human (GRCh38)
Location 10:133164717-133164739
Sequence TCCTGTAGTCACCTCCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865564_1076865573 28 Left 1076865564 10:133164717-133164739 CCCTTCTGGAGGTGACTACAGGA 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG No data
1076865564_1076865567 0 Left 1076865564 10:133164717-133164739 CCCTTCTGGAGGTGACTACAGGA 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1076865567 10:133164740-133164762 CGCCCACAGCTCAGGACTACAGG No data
1076865564_1076865572 27 Left 1076865564 10:133164717-133164739 CCCTTCTGGAGGTGACTACAGGA 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1076865572 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data
1076865564_1076865566 -8 Left 1076865564 10:133164717-133164739 CCCTTCTGGAGGTGACTACAGGA 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1076865566 10:133164732-133164754 CTACAGGACGCCCACAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865564 Original CRISPR TCCTGTAGTCACCTCCAGAA GGG (reversed) Intronic
900300803 1:1976182-1976204 TCCTGCCGTCACCTCCAGGGCGG + Intronic
905464297 1:38141048-38141070 TACTGTAGCAACCTCCAGACAGG + Intergenic
907791642 1:57671556-57671578 GCCTGGAGTCACCTCGTGAAAGG - Intronic
910549913 1:88463862-88463884 TCCTGGATCCACCTCCACAATGG + Intergenic
911094209 1:94042664-94042686 TCCTGTACTCAGCTACAAAATGG + Intronic
914684431 1:149965737-149965759 TCCTCCATTCACCTGCAGAAAGG - Intronic
920043308 1:203117712-203117734 TCCTGAGCTCACCTGCAGAAAGG - Intronic
920738757 1:208560175-208560197 TCCTGGAGGCAGCTGCAGAAAGG + Intergenic
920985460 1:210884853-210884875 GCCTGGTGTCTCCTCCAGAAGGG - Intronic
1064043521 10:11989849-11989871 TCCTTGAGTCACCTCCTGAAAGG + Intronic
1066082411 10:31944600-31944622 TTCTGTAGCCACTTCCTGAAAGG - Intergenic
1068688650 10:59894229-59894251 TTCTGTAGTGAGCTCCTGAAGGG + Intronic
1072818250 10:98530832-98530854 TCCTGGAGTCTTCTCCAGTAGGG - Intronic
1072962230 10:99939869-99939891 TCCTGTGGTCCCACCCAGAAAGG + Intronic
1074460316 10:113630735-113630757 TTCTGTAGACACATCCAAAATGG + Intronic
1074768377 10:116717146-116717168 TCATTTTGTCACCTACAGAATGG - Intronic
1074997476 10:118770367-118770389 ATCTGTGGACACCTCCAGAATGG - Intergenic
1075274818 10:121083983-121084005 TGCTGTAGCCACATGCAGAAAGG - Intergenic
1075483055 10:122798760-122798782 TCATGAAGTCACATCCACAAAGG - Intergenic
1075996022 10:126876896-126876918 TCCTGTGCCCACCTCCACAATGG - Intergenic
1076865564 10:133164717-133164739 TCCTGTAGTCACCTCCAGAAGGG - Intronic
1077289255 11:1781338-1781360 TGCGGGAGCCACCTCCAGAAGGG - Intergenic
1080485812 11:32705233-32705255 TCCTCTAGTCACCTGCAGTGTGG - Intronic
1081660843 11:44887585-44887607 TCCTGTGTTCACCTGCAAAAGGG + Intronic
1081859379 11:46323835-46323857 TCCTGTCCCCTCCTCCAGAAAGG - Intergenic
1084317845 11:68355588-68355610 CCCTGTGGTCACCTCCAAACAGG + Intronic
1085485814 11:76861477-76861499 TGCTGTTGCCACCACCAGAAGGG + Intronic
1086547139 11:88010930-88010952 TCTTGTAGAGACCTCCAGACTGG - Intergenic
1086941422 11:92802026-92802048 TCCTTTACTCAGCTCCAGAGAGG - Intronic
1089125375 11:116172852-116172874 TCCTGTTCTCACCTCCAAAATGG - Intergenic
1091039767 11:132266077-132266099 ACCTGTAACCAGCTCCAGAAAGG - Intronic
1091706503 12:2697080-2697102 TGCTGGAGACACCTCCTGAAGGG - Intronic
1093744300 12:22722196-22722218 ATATGTAGTCACCACCAGAAAGG - Intergenic
1094728635 12:33148697-33148719 TCCTGAAGTTAACTCCAGAGAGG - Intergenic
1095715441 12:45341227-45341249 TGCTGTACTGCCCTCCAGAAAGG - Intronic
1097332467 12:58346703-58346725 TCCTGCATTCACCTTCAAAATGG - Intergenic
1099544798 12:83965125-83965147 TCCTGTAGTCATAGCTAGAAGGG - Intergenic
1103716133 12:122946408-122946430 TCAGGTAGTCAACTCCAGAGAGG + Intronic
1104396865 12:128441570-128441592 CCCTGCAGTCACCTGCAGACAGG + Intronic
1106163277 13:27219467-27219489 AGTTGTAGTCTCCTCCAGAAGGG - Intergenic
1109677021 13:65690245-65690267 TTCTGGAGTTCCCTCCAGAAGGG - Intergenic
1110384652 13:74894749-74894771 AACTGTAGTCTCCTCCAGAATGG - Intergenic
1114640140 14:24214124-24214146 ACCTGCATTCACATCCAGAATGG - Exonic
1114805838 14:25835572-25835594 TCGTGTACTGACTTCCAGAAGGG - Intergenic
1115152286 14:30299705-30299727 TCCTGTATACACTTCGAGAAGGG - Intergenic
1116911070 14:50465121-50465143 TCCTGTCATCATCCCCAGAATGG + Intronic
1125983258 15:44023267-44023289 TCCTGTAACAACCTCCAGATGGG - Intronic
1126080246 15:44953779-44953801 TCCTGTAGTTTCTTCAAGAAAGG + Intergenic
1128142190 15:65310050-65310072 TCCTGGAGGCACCCCCAGCATGG - Intergenic
1131505377 15:93013501-93013523 TGCTGAATTCTCCTCCAGAAAGG - Intronic
1139902595 16:70340080-70340102 TCCTTTATTCACCTCCTAAATGG + Intronic
1140312598 16:73864231-73864253 TTCTATAGCCTCCTCCAGAATGG + Intergenic
1142233107 16:88909035-88909057 GCCTGTGGTCAGCTCCAGGAAGG - Intronic
1142306079 16:89286424-89286446 TCCTGTGCTCTCCTTCAGAAGGG + Intronic
1144562989 17:16337167-16337189 TCCTGTAGTCCCATCCACTAGGG - Intronic
1146689350 17:34862482-34862504 TCCTGTAGTTACCTACACCAGGG + Intergenic
1149119302 17:53142100-53142122 CGCTATAGTCAGCTCCAGAAGGG - Intergenic
1152343789 17:79739406-79739428 TCCTGCAGCCACCTCCAAACTGG - Intronic
1153121846 18:1738273-1738295 GCCTGAAGCCACCTCGAGAAAGG + Intergenic
1153840625 18:9004871-9004893 TCCCGTGCACACCTCCAGAATGG + Intergenic
1155242641 18:23878216-23878238 TTCTGTAGTCACCCACTGAAAGG + Intronic
1157316497 18:46594205-46594227 TTCTCAAGTCTCCTCCAGAAAGG - Intronic
1157583860 18:48788756-48788778 TTCTGTAGTGACCTCCCCAAGGG - Intronic
1160300734 18:77675698-77675720 TCCTATAGGCACCTGCACAATGG - Intergenic
1160820806 19:1056889-1056911 TCATGTCTTCACCTCCAGGATGG + Exonic
1164604880 19:29590614-29590636 TGCAGTAGCCACCTCCAAAACGG + Intergenic
1164882247 19:31742037-31742059 CCCTGGAGACACCTCCAGAAAGG + Intergenic
1166067051 19:40366120-40366142 ACCTGTAGACACCCCAAGAAAGG - Intronic
1166822423 19:45588637-45588659 TCCTGCAGTCACCTCCTCACTGG + Intronic
1167767486 19:51493238-51493260 TCCTGTAGTTAAGTCAAGAAGGG - Intronic
1168513384 19:56991332-56991354 TCCTGGAGTCAGATCCAGGATGG + Intergenic
925083889 2:1092417-1092439 TCCTGTCCTCACCACAAGAAGGG + Intronic
926942884 2:18156513-18156535 ACCTGAAGTCAGTTCCAGAAGGG - Intronic
927275428 2:21258382-21258404 TCCTTTAGCCACCTCCTCAAGGG + Intergenic
931067104 2:58599327-58599349 GTCTGTAGTCAACTCAAGAAAGG + Intergenic
931547769 2:63408297-63408319 TCCTGAACACACCCCCAGAATGG + Intronic
933249638 2:80014890-80014912 TCCTTTAATCACCTCAAGATGGG + Intronic
934475722 2:94592160-94592182 TTCTGTGGTTACCTCCAGCATGG + Intronic
934915130 2:98295479-98295501 TCCTGTATTCAGCTGGAGAAAGG - Intronic
934992548 2:98931744-98931766 ACCAGCAGTCTCCTCCAGAATGG + Intronic
936630129 2:114193056-114193078 TGCTGTTGTCACCTCCAGGTAGG + Intergenic
938158153 2:128958915-128958937 TACTTTAGTCACCTCTTGAAAGG - Intergenic
942568768 2:177292265-177292287 TCCTTTAGTCACTTACAGAGAGG - Intronic
945105067 2:206303692-206303714 TCCTGTAGTCACTTCCCTAGAGG + Intronic
946456675 2:219832155-219832177 TCCTGGAGGGAGCTCCAGAAGGG + Intergenic
947538892 2:230960919-230960941 TCCTGGGGTTACCTCCAGGAAGG + Intronic
948880720 2:240855964-240855986 CCCTGCAGCCACCTCCAGAAAGG + Intergenic
1174607962 20:51774768-51774790 TTCTGTTTTCACCTCCAAAAAGG + Intergenic
1175081845 20:56427203-56427225 CTGTGAAGTCACCTCCAGAAGGG - Intronic
1176151190 20:63591905-63591927 TCCTGGAGTCACCGCCACCACGG - Intronic
1177673623 21:24267754-24267776 TTATGTATTCACCTCCTGAAGGG + Intergenic
1178394459 21:32229567-32229589 GTCTGCAGTCACCTTCAGAAAGG - Intergenic
1180045595 21:45303711-45303733 TACTGTAATCACCTCCTTAAAGG - Intergenic
1180127067 21:45800119-45800141 TCCTGCAGCCTCCTCCAAAAAGG - Intronic
1180814463 22:18780992-18781014 TCCTGGAGTCAGCTCCAGACAGG + Intergenic
1181200651 22:21215328-21215350 TCCTGGAGTCAGCTCCAGACAGG + Intronic
1181700353 22:24617461-24617483 TACTGCAGTGACCTCCAGACAGG - Intronic
1203226266 22_KI270731v1_random:80107-80129 TCCTGGAGTCAGCTCCAGACAGG - Intergenic
1203264562 22_KI270734v1_random:6679-6701 TCCTGGAGTCAGCTCCAGACAGG + Intergenic
950004808 3:9684870-9684892 TCCTGTGGTCTCTTCCAGGATGG + Exonic
953171961 3:40514918-40514940 TCCTGAGGTCACATCCAGAAAGG - Intronic
957584537 3:82116652-82116674 TCCCCTAGTCACCTCGAGGATGG - Intergenic
958626432 3:96630892-96630914 TGCAGTAGTCACCTCTGGAAAGG + Intergenic
958890690 3:99779440-99779462 TTCTGTAGTCACTCCCACAAGGG + Intronic
960745433 3:120882694-120882716 TTCTGTAGTCATCTCCAGGAGGG - Intergenic
963321019 3:143809504-143809526 TGCTGTACTAACCTCCAGATGGG + Intronic
968392009 4:201070-201092 TCCTGTAGTGACCTGGGGAAAGG - Intergenic
969893184 4:10278523-10278545 TCCTCTTGTAACCTCCAGACAGG - Intergenic
971467451 4:26978665-26978687 TGCTGCTGTGACCTCCAGAATGG + Intronic
971709801 4:30096202-30096224 TACTGCATTCAACTCCAGAAGGG - Intergenic
973560854 4:52133909-52133931 TCCAGCACTCACCTCCAGACAGG + Intergenic
973759715 4:54104591-54104613 TCCTTTGGTCACTTTCAGAATGG + Intronic
978964806 4:114727484-114727506 TCCTCTAGTCCACTACAGAATGG - Intergenic
988296509 5:29369951-29369973 ACCTGTAGTCAGCTCCAATATGG - Intergenic
990495263 5:56341042-56341064 TCCAGTAGTCAGCTGGAGAAGGG - Intergenic
992894555 5:81234958-81234980 TCCAGCAGTCACCTTCAGCATGG - Intronic
997430313 5:133833870-133833892 TTCTGTAGTCAGATCCAAAAGGG - Intergenic
998387329 5:141765054-141765076 TCCTGCTGTCAGATCCAGAAGGG + Intergenic
1002091103 5:176806988-176807010 TCCTGAAGGCATCTCCTGAAGGG - Intergenic
1002935987 6:1672903-1672925 TTCTTTTGTCACATCCAGAAAGG - Intronic
1004414188 6:15409811-15409833 TCCTGCAGGCAATTCCAGAAAGG + Intronic
1007694046 6:43720311-43720333 GCTTGAAGTCACCTCCAGCAAGG - Intergenic
1010705092 6:79098939-79098961 GTCTGTAGTCAACCCCAGAAGGG - Intergenic
1011329022 6:86183575-86183597 TCCTGTCATCTCCACCAGAAAGG - Intergenic
1015604273 6:134939076-134939098 TCCTGTCTTCAACACCAGAACGG - Intronic
1019165718 6:170096343-170096365 GCCTGGAGCCACCTCCAGGAGGG + Intergenic
1020793271 7:12652610-12652632 TCCTCTTGTCTCTTCCAGAAGGG - Exonic
1021194489 7:17660147-17660169 ACCTGAAGTCACCTAAAGAAGGG + Intergenic
1024529704 7:50381549-50381571 TCCCTTTGTCAGCTCCAGAATGG + Intronic
1026436253 7:70401449-70401471 TCCTGTGGTCAGCTCCAGCTTGG - Intronic
1029362646 7:100098504-100098526 TCCTGTAGTCACTTGTGGAATGG - Intronic
1030287673 7:107843236-107843258 TGCTGAAATCACCTCCTGAAAGG - Intergenic
1034149626 7:148904195-148904217 TCATGTAGTCACCCACAGATGGG - Intergenic
1035655954 8:1305054-1305076 TCCTGGGGTCACCTCCAGGTGGG - Intergenic
1036423244 8:8617738-8617760 TCCTGTATTCTCCCTCAGAAAGG + Intergenic
1038839096 8:31162464-31162486 TCTTCTGGACACCTCCAGAAGGG + Intronic
1039340705 8:36646838-36646860 TACTGTACTCATCTCCTGAAGGG + Intergenic
1049076834 8:140403612-140403634 TCCTGTATTGTCCTCCAAAAAGG - Intronic
1052854334 9:33397757-33397779 TTCTGTGGTTACCTCCAGCATGG - Intronic
1053682342 9:40493918-40493940 TTCTGTGGTTACCTCCAGCATGG - Intergenic
1053932324 9:43122244-43122266 TTCTGTGGTTACCTCCAGCATGG - Intergenic
1054281372 9:63131011-63131033 TTCTGTGGTTACCTCCAGCATGG + Intergenic
1054295442 9:63329418-63329440 TTCTGTAGTTACCTCCAGCATGG - Intergenic
1054393459 9:64633922-64633944 TTCTGTGGTTACCTCCAGCATGG - Intergenic
1054428109 9:65139136-65139158 TTCTGTGGTTACCTCCAGCATGG - Intergenic
1054502270 9:65882408-65882430 TTCTGTGGTTACCTCCAGCATGG + Intronic
1056704712 9:88942073-88942095 TCCCTTAGTCTCTTCCAGAAAGG + Intergenic
1058951507 9:109908032-109908054 TCTTGTGGTCACCTACAGCATGG - Intronic
1060734143 9:126055605-126055627 TCCCGCAGGCACCTCCAGAGGGG - Intergenic
1188538799 X:31226713-31226735 TCCTGTCCTCCCCTCCAGATTGG + Intronic
1191898365 X:66016909-66016931 GACTTTATTCACCTCCAGAAAGG - Intergenic
1194192814 X:90858093-90858115 TCCTCCAGACCCCTCCAGAATGG + Intergenic
1194641238 X:96406258-96406280 TCCTGTGGCCCCATCCAGAAGGG + Intergenic
1195541425 X:106067682-106067704 TGCTGTAAACACCTCCACAAAGG - Intergenic
1198596141 X:138237933-138237955 TCCTGGATTCTCCTCCAGAAAGG - Intergenic
1200539438 Y:4440541-4440563 TCCTCCAGACCCCTCCAGAATGG + Intergenic
1200706949 Y:6451244-6451266 GCCTGTAGTAACGTCAAGAAGGG - Intergenic
1201027163 Y:9713464-9713486 GCCTGTAGTAACGTCAAGAAGGG + Intergenic