ID: 1076865565

View in Genome Browser
Species Human (GRCh38)
Location 10:133164718-133164740
Sequence GTCCTGTAGTCACCTCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865565_1076865572 26 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1076865572 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data
1076865565_1076865566 -9 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1076865566 10:133164732-133164754 CTACAGGACGCCCACAGCTCAGG No data
1076865565_1076865574 30 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1076865574 10:133164771-133164793 ATAGCTCCCGACCTTGAGGGTGG No data
1076865565_1076865573 27 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG No data
1076865565_1076865567 -1 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1076865567 10:133164740-133164762 CGCCCACAGCTCAGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865565 Original CRISPR GTCCTGTAGTCACCTCCAGA AGG (reversed) Intronic
900651655 1:3732787-3732809 GTCCTGCAGGCCCCGCCAGATGG - Exonic
901573161 1:10178372-10178394 GTCCTGCAGCCCTCTCCAGAGGG + Intronic
901733322 1:11296087-11296109 GTCTTGCAGCCACCTGCAGATGG - Intergenic
906114352 1:43346556-43346578 GGGCTGTGGTCACCTCCACAAGG - Exonic
906920867 1:50063064-50063086 GTCCTCTAGACCCCTCCAGTTGG + Intronic
907238474 1:53067385-53067407 GGTCTGTTGTCCCCTCCAGATGG + Intronic
907998897 1:59660915-59660937 ATCCTGAAATCACATCCAGAAGG + Intronic
909339712 1:74518073-74518095 GTCCTCTAGTAACCTGCACACGG - Intronic
1063049539 10:2431955-2431977 GTGCTGTATTCATTTCCAGATGG - Intergenic
1063595025 10:7427108-7427130 TTCCTGTAGTGCCTTCCAGAAGG + Intergenic
1064736641 10:18388402-18388424 GTTCTGAAATCACCTCCTGAAGG + Intronic
1065233302 10:23621235-23621257 TTTCTGCAGTCACCTCCAAATGG + Intergenic
1072867355 10:99078303-99078325 GTCCTGGAATCAACTCCTGATGG - Intronic
1076865565 10:133164718-133164740 GTCCTGTAGTCACCTCCAGAAGG - Intronic
1081994372 11:47354108-47354130 GTCCTGTGTTTTCCTCCAGACGG - Intergenic
1085460604 11:76690846-76690868 GACCTGTAGTCAGCTCAAAATGG + Intergenic
1087194209 11:95288687-95288709 TTCCAGGAGTCACCCCCAGATGG - Intergenic
1088539397 11:110897431-110897453 GACCTGTAGTCCCCTCCACCTGG + Intergenic
1089602440 11:119624083-119624105 GTCCTGTACTGACCTCCACTTGG + Intronic
1090874020 11:130773091-130773113 GCCCTGTAGCCACCTGCAAAGGG + Intergenic
1092197818 12:6560530-6560552 GCGCTGTGCTCACCTCCAGAAGG - Exonic
1099544799 12:83965126-83965148 GTCCTGTAGTCATAGCTAGAAGG - Intergenic
1107310726 13:39074146-39074168 GGCATGTATTCACCTTCAGAGGG - Intergenic
1107746690 13:43517764-43517786 GTGATGTAGTCACCTCCCAAAGG - Intronic
1112116890 13:96366065-96366087 ATCCTTTAGTCACCTCCCTAGGG - Intronic
1113461315 13:110484480-110484502 CTCCTGTAGGCACCTTCACAGGG - Intronic
1116421013 14:44732300-44732322 GTCCTGTTGACCCCTCCAGGGGG - Intergenic
1119927513 14:78509646-78509668 GTGTTGTTTTCACCTCCAGAGGG + Intronic
1124206794 15:27727762-27727784 GTCCTGCAGGCACCACCACAGGG + Intergenic
1124499881 15:30218527-30218549 GTCCTGACGTGGCCTCCAGATGG - Intergenic
1124743696 15:32320137-32320159 GTCCTGACGTGGCCTCCAGATGG + Intergenic
1125983259 15:44023268-44023290 TTCCTGTAACAACCTCCAGATGG - Intronic
1135396297 16:22134264-22134286 GCCCTCAAGTCACCTCCAGGTGG + Intronic
1142103976 16:88292170-88292192 GCCCTGGAGTCACCTGCAGTGGG + Intergenic
1146578033 17:34011977-34011999 TTCCTGCAGGCACCTCCAGGAGG + Intronic
1151228565 17:72665139-72665161 ATCATGTAGGCACCTCCACATGG - Intronic
1153614411 18:6921022-6921044 GACCTCTAGTCAACTGCAGATGG - Intergenic
1157325912 18:46668844-46668866 GTCCTGTACTCTTCTCCAGTGGG - Intronic
1159158818 18:64618230-64618252 GACCTGTAGTCTCATACAGAGGG - Intergenic
1163133529 19:15292281-15292303 GTCATGAAGGCACCTCCAGATGG - Intronic
1163324620 19:16595145-16595167 GTCCAGGAGTCACCTCCAGTAGG + Intronic
1167485235 19:49758821-49758843 GTGGTGTAGTAACCTCCACAAGG - Intronic
1167767487 19:51493239-51493261 GTCCTGTAGTTAAGTCAAGAAGG - Intronic
926348138 2:11968285-11968307 GTCCTGTCGGCACTTGCAGATGG - Intergenic
926478454 2:13357494-13357516 CTCCTGTAGTCACCACCACTAGG - Intergenic
931044269 2:58332668-58332690 GGCCTTTAGTCATGTCCAGAAGG + Intergenic
933249637 2:80014889-80014911 TTCCTTTAATCACCTCAAGATGG + Intronic
946456674 2:219832154-219832176 GTCCTGGAGGGAGCTCCAGAAGG + Intergenic
948718654 2:239882444-239882466 TTCCTGAAGTCGCCACCAGATGG - Intergenic
1168928326 20:1600743-1600765 CTCCTGTATCCACCTCCAGTTGG + Intronic
1170688181 20:18587973-18587995 TTCCGGGTGTCACCTCCAGAGGG + Exonic
1178778741 21:35578696-35578718 GTCCTTGAGACACCTGCAGAGGG + Intronic
950093431 3:10313591-10313613 GTCCTGTTGTCCCAGCCAGAGGG - Intronic
950705338 3:14776026-14776048 GTCCTGGATGCACCTCCACAGGG - Intergenic
952087084 3:29836961-29836983 GTCCTCTCATGACCTCCAGATGG + Intronic
954297216 3:49680982-49681004 GCCCTCTACCCACCTCCAGAAGG - Intronic
960524784 3:118697140-118697162 ATCCTAAAGTCTCCTCCAGAAGG + Intergenic
960745434 3:120882695-120882717 TTTCTGTAGTCATCTCCAGGAGG - Intergenic
962383423 3:134914545-134914567 GTCCTGTAGTCCCCCACACAAGG - Intronic
962597063 3:136956967-136956989 GTCCTGGAGTCACCTCCTCCAGG + Intronic
962808231 3:138941638-138941660 GTCCTGTACCCTACTCCAGAGGG - Intergenic
963321018 3:143809503-143809525 CTGCTGTACTAACCTCCAGATGG + Intronic
965061015 3:163786267-163786289 GTCCTGAGGTCACCTGCATAGGG + Intergenic
965278040 3:166713143-166713165 CTCCTTTAGACACCACCAGAAGG + Intergenic
968812766 4:2807588-2807610 TACCTGCAGTCACCTCCACATGG - Intronic
971929434 4:33061134-33061156 GCCCTGTGGCCACCACCAGAGGG - Intergenic
976087242 4:81418895-81418917 GCCCTGTACTCACATGCAGAAGG + Intergenic
983627957 4:169821974-169821996 GGCCTCTAGTCACCTCCCAAAGG + Intergenic
985530637 5:431841-431863 GTCCTCTGGGCACCTCCAGGAGG - Intronic
985892736 5:2728552-2728574 TTCCTGTAGCCACATCCACATGG - Intergenic
988509766 5:31855141-31855163 GTTCTGAAGTCACCTTCGGAGGG - Intronic
989328956 5:40233061-40233083 ATCCTGTCTTCATCTCCAGAAGG + Intergenic
990654627 5:57941522-57941544 GCTCTAAAGTCACCTCCAGAGGG - Intergenic
998038995 5:138939164-138939186 GTCCTGTAACCACCACCACAAGG + Intergenic
998387328 5:141765053-141765075 GTCCTGCTGTCAGATCCAGAAGG + Intergenic
1000758120 5:165185896-165185918 TTCCTGTAGTAATCCCCAGAAGG + Intergenic
1006793622 6:36718851-36718873 AGCCTGTAGTCACTTCCAGGTGG + Intronic
1008409530 6:51158309-51158331 TTCCTTTAGTCAGTTCCAGATGG - Intergenic
1014915311 6:127139784-127139806 GTCCTCTATTCACCTCCACTTGG + Intronic
1015547472 6:134376229-134376251 TGCCTGTAGTCACATCCAAAAGG + Intergenic
1016377741 6:143440928-143440950 GTCCTGAAGGCACCCACAGAAGG + Intronic
1017544888 6:155439850-155439872 GTCCTGTAGTCACCGCACGCCGG + Intronic
1020793272 7:12652611-12652633 GTCCTCTTGTCTCTTCCAGAAGG - Exonic
1023054578 7:36281204-36281226 GCCCTCGAGTCAGCTCCAGAAGG + Exonic
1030763329 7:113378249-113378271 GTCCTGTTCTCAGCTCCAGCTGG - Intergenic
1034149627 7:148904196-148904218 TTCATGTAGTCACCCACAGATGG - Intergenic
1034272287 7:149809083-149809105 TTCCTGTAGCCACCACCACAGGG - Intergenic
1035018179 7:155784413-155784435 GTCCTCTAGTCACCTGCAGTGGG - Intergenic
1035655955 8:1305055-1305077 TTCCTGGGGTCACCTCCAGGTGG - Intergenic
1035700294 8:1633420-1633442 GCCCTGTAGTGACGTCCAGCCGG + Intronic
1046611124 8:116426688-116426710 TCCCTGTAGGCACCTCCACAGGG + Intergenic
1048529167 8:135231992-135232014 TCTCTGTAGTCACCTCGAGAAGG + Intergenic
1049367368 8:142246916-142246938 GTGCTGTGGTCACTTTCAGATGG - Intronic
1055793606 9:79949916-79949938 GTCCTGTAGGCTGCTCCACATGG - Intergenic
1056244742 9:84683044-84683066 ATGATGTAATCACCTCCAGAAGG + Intronic
1057767188 9:97932082-97932104 GTCCTGTAGTCTCTTAGAGAAGG - Intronic
1060734144 9:126055606-126055628 TTCCCGCAGGCACCTCCAGAGGG - Intergenic