ID: 1076865565

View in Genome Browser
Species Human (GRCh38)
Location 10:133164718-133164740
Sequence GTCCTGTAGTCACCTCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865565_1076865572 26 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC No data
Right 1076865572 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data
1076865565_1076865573 27 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC No data
Right 1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG No data
1076865565_1076865566 -9 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC No data
Right 1076865566 10:133164732-133164754 CTACAGGACGCCCACAGCTCAGG No data
1076865565_1076865567 -1 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC No data
Right 1076865567 10:133164740-133164762 CGCCCACAGCTCAGGACTACAGG No data
1076865565_1076865574 30 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC No data
Right 1076865574 10:133164771-133164793 ATAGCTCCCGACCTTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865565 Original CRISPR GTCCTGTAGTCACCTCCAGA AGG (reversed) Intronic