ID: 1076865568

View in Genome Browser
Species Human (GRCh38)
Location 10:133164742-133164764
Sequence GTCCTGTAGTCCTGAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 171}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865568_1076865579 14 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865579 10:133164779-133164801 CGACCTTGAGGGTGGTCGTGGGG No data
1076865568_1076865578 13 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865578 10:133164778-133164800 CCGACCTTGAGGGTGGTCGTGGG No data
1076865568_1076865574 6 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865574 10:133164771-133164793 ATAGCTCCCGACCTTGAGGGTGG No data
1076865568_1076865581 25 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865581 10:133164790-133164812 GTGGTCGTGGGGTTGTCTGCTGG No data
1076865568_1076865572 2 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865572 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data
1076865568_1076865582 26 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865582 10:133164791-133164813 TGGTCGTGGGGTTGTCTGCTGGG No data
1076865568_1076865573 3 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG No data
1076865568_1076865576 12 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865576 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865568 Original CRISPR GTCCTGTAGTCCTGAGCTGT GGG (reversed) Intronic
904477689 1:30775514-30775536 GTCCTGAAGGGCTGAGCAGTTGG - Intergenic
904853802 1:33479678-33479700 GTCCTGCAGTCCTGGTCTCTCGG - Exonic
909745979 1:79097793-79097815 GTCCTTCTGTCCTAAGCTGTGGG + Intergenic
909806187 1:79876099-79876121 GTTCTGTGGTCCTGAGCTGGAGG - Intergenic
910127762 1:83861950-83861972 GTCCTGTTTTTCTGAGCAGTAGG - Intergenic
910364162 1:86446191-86446213 CTTCTGTAGTGGTGAGCTGTGGG + Intronic
917469346 1:175313484-175313506 GTCCCATAATCCTGAGCTATAGG + Intergenic
918017497 1:180650316-180650338 GTCTTGAACTCCTGAGCTGTAGG + Intronic
920667258 1:207972097-207972119 GGCCTGGAATCCTGAGATGTGGG - Intergenic
920798643 1:209165347-209165369 CTTCTATAGTTCTGAGCTGTGGG - Intergenic
922471064 1:225877594-225877616 GTCCTGTTGTCCTGTGCTCCAGG - Exonic
924183035 1:241458381-241458403 GGCCTTGAGTCCTGAGCTGCTGG - Intergenic
1062861448 10:813541-813563 CTTCTGTTGTCCTGAGCTGGCGG - Intronic
1063109508 10:3022371-3022393 GTGCTGACATCCTGAGCTGTGGG - Intergenic
1063367690 10:5500990-5501012 GTCCTGGGGGACTGAGCTGTGGG - Intergenic
1063454431 10:6173297-6173319 AACCTGTAGTCCTCAGCTGCTGG + Intronic
1067425031 10:46202804-46202826 TTCCTGTATTTCAGAGCTGTGGG - Intergenic
1073424026 10:103445524-103445546 GTCCTCTAGCACTGAGCTCTTGG - Exonic
1074414627 10:113256575-113256597 GTCTTGAACTCCTGAGCTGAAGG - Intergenic
1076289928 10:129337535-129337557 TTCCTGTGTTCCTGACCTGTGGG - Intergenic
1076865568 10:133164742-133164764 GTCCTGTAGTCCTGAGCTGTGGG - Intronic
1078663567 11:13306313-13306335 GTCCTGAAGTCCTGAGGTCCTGG + Intronic
1085047695 11:73363023-73363045 ATTCTGTAGTGCTGAGCTGTCGG + Intronic
1085283796 11:75347100-75347122 GTCCAGAGGTCCTGAGTTGTGGG - Intronic
1086055362 11:82640208-82640230 GCCCAGGAGTCCTGAGCTCTGGG + Intergenic
1089005565 11:115087885-115087907 GTCCTGTGGTGCCTAGCTGTAGG - Intergenic
1098842423 12:75492465-75492487 GTCCTGTAACCCTGATCTATTGG - Exonic
1101367853 12:104092246-104092268 GTCTTGAACTCCTGAGCTGAAGG - Intronic
1102038842 12:109787771-109787793 GTGCTGTATTCCTGGGCCGTGGG + Intronic
1104161313 12:126183476-126183498 GTCCTGTGGTTCTGGGCTCTGGG + Intergenic
1104700121 12:130896697-130896719 GTCTTGAACTCCTGAGCTGAAGG + Intergenic
1104918553 12:132278799-132278821 CTCCTGTGGTCCTCAGCTGCAGG - Intronic
1106464940 13:30005141-30005163 ACCCTGAAGTCCTGAGGTGTGGG + Intergenic
1106759180 13:32850845-32850867 TTCCTTTAGTGCTGAGCCGTGGG + Intergenic
1108783327 13:53864539-53864561 GTCCAGTGGTTCTCAGCTGTAGG + Intergenic
1109211459 13:59539814-59539836 GACTGGTTGTCCTGAGCTGTGGG - Intergenic
1111337946 13:86846819-86846841 GTTCTGCAGTCCTGAGCTGGGGG - Intergenic
1111905768 13:94254186-94254208 GGCCTTTCTTCCTGAGCTGTAGG + Intronic
1114278631 14:21169893-21169915 GTTCTGCAGTCATGAGCTGGGGG - Intergenic
1116931118 14:50692030-50692052 GTCTTGAACTCCTGAGCTGAAGG + Intergenic
1121294105 14:92803251-92803273 GTCTTGAACTCCTGAGCTGAAGG + Intronic
1123139480 14:106061460-106061482 GTCCTGCAGACCTGAGCCCTGGG + Intergenic
1123144514 14:106115951-106115973 GTCCTGCAGACCTGAGCCCTGGG + Intergenic
1123207495 14:106727467-106727489 GTCCTGCAGACCTGATCTCTGGG + Intergenic
1123212518 14:106774461-106774483 GTCCTGCAGACCTGATCTCTGGG + Intergenic
1123218957 14:106839243-106839265 GTCCTCTGGTCCTGGGCTGCCGG + Intergenic
1125768321 15:42149590-42149612 GGCCTGTTCACCTGAGCTGTGGG - Intronic
1126489941 15:49225761-49225783 ATGCTGCAGCCCTGAGCTGTTGG + Intronic
1127693582 15:61421813-61421835 GTCTTGATGTCCTGCGCTGTGGG - Intergenic
1128745495 15:70111440-70111462 GTCCTTTCCTCCAGAGCTGTAGG - Intergenic
1129419454 15:75412140-75412162 GTCCTGTAGAACTGAGATGATGG + Intronic
1131335725 15:91546790-91546812 GACCGGGAGTCTTGAGCTGTGGG - Intergenic
1132702113 16:1226363-1226385 GTCCTCTAGTCCTGACCTCTAGG + Intergenic
1132706207 16:1244505-1244527 GTCCTCTAGTCCTGACCTCTAGG - Intergenic
1132892308 16:2210333-2210355 GTCCTGCAGCCCAGAGCTGGAGG - Intronic
1134217890 16:12330532-12330554 CACCTGTCGTCCAGAGCTGTCGG - Intronic
1135073365 16:19371689-19371711 GTCTTGAACTCCTGAGCTGTAGG - Intergenic
1135128277 16:19829707-19829729 GTCCTTTAGGCCTGTGCTCTCGG + Intronic
1135210327 16:20520504-20520526 GTCCAGTAGTTCTTAGTTGTGGG + Intergenic
1135701910 16:24640180-24640202 GTCTTGAAGTCCTGAGCTCTAGG - Intergenic
1136870053 16:33798650-33798672 GTCCTGCAGACCTGAGCCCTGGG - Intergenic
1139961739 16:70721917-70721939 GTCCTGTGCTCCTGTGCTGTGGG - Intronic
1203102117 16_KI270728v1_random:1317404-1317426 GTCCTGCAGACCTGAGCCCTGGG + Intergenic
1145231800 17:21178418-21178440 CTCCTGGACTGCTGAGCTGTAGG + Intronic
1145834231 17:27941808-27941830 GTCCTGCAGGCCTGAGCATTGGG + Intergenic
1147330274 17:39695260-39695282 GGCCTGCATTCCTGAGATGTGGG + Intronic
1148230069 17:45927266-45927288 GGCCAGTAGTCCTTAGATGTTGG + Intronic
1149177514 17:53891806-53891828 CTCCAGAAGTCCTGATCTGTAGG - Intergenic
1152132017 17:78483259-78483281 TTCCTATAGTCGTGAGCTCTGGG + Intronic
1154160563 18:11978343-11978365 TGCCTGTAGTCCCCAGCTGTGGG - Intergenic
1154410200 18:14136139-14136161 GTCCTGGAGTCTGGAGCTGCTGG + Intergenic
1160630681 18:80245184-80245206 ATCCTGCAGTCCTGGGCTGCTGG - Intronic
1161046221 19:2136295-2136317 GACCTGAAGTCCTGGGCTGGGGG - Intronic
1161945038 19:7430325-7430347 TGCCTGTAGTCCTGAGCACTCGG - Intronic
1162100102 19:8334163-8334185 GTTCTGGAGTCCTGCGATGTGGG + Intronic
1162473991 19:10888919-10888941 CCCCTGTAGTCCTGACCTGTGGG - Intronic
1162749347 19:12819024-12819046 GTCTTGAAGTCCTGAGCTCAAGG + Intronic
1163132067 19:15280560-15280582 GTGCTGAAGTCATGAGGTGTGGG + Intronic
1163557675 19:18001723-18001745 GTCTTGAACTCCTGACCTGTGGG - Intronic
1163628354 19:18403693-18403715 GTCCTGGGGTCCTGAGGTCTGGG + Intergenic
1163747047 19:19054868-19054890 GCCCTGTACTCCTGGGCAGTTGG + Intronic
1165248000 19:34508725-34508747 GTCCGGAAGTGCTGAGCTGCAGG + Exonic
1166096659 19:40543513-40543535 GTTCTGTAGTGCAGAGTTGTTGG - Intronic
1168250274 19:55137739-55137761 GTCCTGGACTCCTGGGCTGAGGG - Intronic
925728088 2:6894027-6894049 GTTATGTAGTCCTGGGCTGGAGG + Intronic
931390347 2:61837115-61837137 GCCTTGTACTCCTGAGGTGTTGG + Intronic
934983613 2:98868640-98868662 GTCCTTTGGTGCTGAGCTTTAGG + Intronic
939275393 2:139991802-139991824 GTGTTGTGGGCCTGAGCTGTGGG + Intergenic
944583352 2:201152331-201152353 TTCCTGTAGTGCTGAGTTCTCGG + Intronic
944820895 2:203429774-203429796 CTTCTGTAGTGGTGAGCTGTGGG - Exonic
948045600 2:234941180-234941202 GTCCTGGAGTCAGGAGCTGTGGG + Intergenic
1172578815 20:36030753-36030775 GGCCTGGAGGGCTGAGCTGTGGG + Intergenic
1172754405 20:37273201-37273223 ATCCTGGAGGCCTGAGCTGGGGG + Intergenic
1174556199 20:51397364-51397386 GGACTGTAGCCCAGAGCTGTGGG + Intronic
1174753282 20:53133332-53133354 GTCATGTACTGCTGAGCTGTGGG - Intronic
1175130946 20:56789068-56789090 ATCCTGGAGCCCTGGGCTGTGGG + Intergenic
1175276502 20:57774422-57774444 GTCCCTTAGCCCTGACCTGTTGG + Intergenic
1175814320 20:61875652-61875674 ATCCTGCAGTCCTGAGGTGAAGG - Intronic
1179728418 21:43353794-43353816 GTCATGTCGTCCTGGGCTGTCGG - Intergenic
1179960619 21:44765341-44765363 GTTCTGTGGTCCTGCCCTGTGGG - Intergenic
1180022237 21:45135813-45135835 GTCCTGTGGTCCTGGACTGCAGG + Intronic
1180983246 22:19889249-19889271 GTCCTCTGGGCCTGAGCTGGGGG - Intronic
1182237535 22:28887717-28887739 CTCCTGTAGTTCTGAAGTGTGGG + Intronic
1183208178 22:36433491-36433513 GTCCTGTTGACCTTGGCTGTGGG - Intergenic
1183483934 22:38079332-38079354 GTCCTGAACTCCTGAGCTCAAGG + Intronic
1185219673 22:49623058-49623080 GCCCAGTTGTCCTGACCTGTAGG + Intronic
950594114 3:13963835-13963857 GTCATTTACTCCTGAGCTTTTGG + Intronic
950650434 3:14403621-14403643 GTCCAGCAGTCCTGAGTGGTGGG + Intronic
950779166 3:15376190-15376212 TTCCAGTACTCCTGATCTGTGGG - Intergenic
952244960 3:31577939-31577961 GTCCTGATGTCCTGAGATTTGGG + Intronic
954009130 3:47619487-47619509 CTCCTGCAGTCCTCAGCTGTGGG - Intronic
954092607 3:48297052-48297074 GTCCTGTGGTCTTGAGCTCAAGG - Intronic
954363375 3:50134010-50134032 GCCCTGTAGTCCTTGGCTTTGGG - Intergenic
954638706 3:52085427-52085449 GGCCTTTATTCCTGAGCTCTTGG - Intronic
956420619 3:69082861-69082883 GTCATGCAGTTCTGAGCAGTTGG + Intergenic
959466495 3:106693777-106693799 GCTCTGTAATCCTGAGTTGTTGG - Intergenic
959625561 3:108445975-108445997 ATCCTGGAGTCTGGAGCTGTGGG - Intronic
960842170 3:121970935-121970957 GTCTTGAAGTCCTGAGCTCAAGG + Intergenic
975624833 4:76335704-76335726 GGCCTGTAGTCCTCAGCTACTGG - Intronic
976216853 4:82723119-82723141 TTCCTGTAGTTCTGAGGTGAAGG - Intronic
977724286 4:100276986-100277008 GCCCTTAAGTCTTGAGCTGTGGG + Intergenic
980651716 4:135725663-135725685 GTCTTGTAGACCTCACCTGTAGG - Intergenic
990395498 5:55374501-55374523 GTCTTGAACTCCTGAGCTGAAGG + Intronic
991643981 5:68782099-68782121 GTCTTGAACTCCTGAGCTGAAGG + Intergenic
992161173 5:74003760-74003782 GTCTTGAAGTCCTGAGCTCAAGG + Intergenic
993038506 5:82784926-82784948 GTCCTGTAGTCCTGTTATGGTGG - Intergenic
995271028 5:110219948-110219970 GTTCTGTGGTTCTGAGCTGGGGG + Intergenic
996475565 5:123916185-123916207 TTCCTCCAGTCATGAGCTGTGGG + Intergenic
996514603 5:124355857-124355879 GTTCTGTTGTACTGAACTGTCGG + Intergenic
1001380144 5:171300578-171300600 GTCCTGTAGACGTCAGCAGTGGG - Intergenic
1001681921 5:173564235-173564257 TTCCTGTAGCCCTGAGCCCTGGG - Intergenic
1001966701 5:175914637-175914659 TGCCTGTAGCCCTGAGATGTGGG + Intergenic
1002250247 5:177924567-177924589 TGCCTGTAGCCCTGAGATGTGGG - Intergenic
1002986260 6:2192151-2192173 CTCCTGTAGTCTGCAGCTGTCGG - Intronic
1003513934 6:6803160-6803182 GCCCTGCAGTCCTGCTCTGTCGG + Intergenic
1004746679 6:18515965-18515987 GTCATGCATTCCAGAGCTGTGGG + Intergenic
1006528580 6:34629818-34629840 CTCCTGTATCCATGAGCTGTGGG - Intronic
1006628639 6:35415227-35415249 GTCCTGTTTGCCTGAACTGTGGG - Intronic
1011070881 6:83381592-83381614 GTCTTGTAGTCCTGTACTGATGG - Intronic
1013174469 6:107665456-107665478 GTCCTGGAGTCCTGAGCAGCAGG + Intergenic
1014795007 6:125714701-125714723 GTCATAAACTCCTGAGCTGTGGG + Intergenic
1015168945 6:130229504-130229526 GTCTTGTGCTCCTGAGCTATTGG + Intronic
1016289005 6:142507098-142507120 GTTCTGTGGTCATGAGCTGGGGG + Intergenic
1018291184 6:162293715-162293737 GACCTGTACTCCAGGGCTGTGGG + Intronic
1018543623 6:164912100-164912122 GTCCTGTAGTCCGTAGCTGACGG - Intergenic
1018730756 6:166648753-166648775 GTCCTGAGGTCCTGAACTTTGGG + Intronic
1018742531 6:166741589-166741611 GTCCTTTAGTACTGTGCTGAGGG + Intronic
1024972994 7:55087771-55087793 TTCCTGTAGGCCTCAGCTGTTGG - Intronic
1028077507 7:86534340-86534362 GATCTGTGGTCCTGAGCTGGAGG + Intergenic
1030426760 7:109387827-109387849 GCCCAGTGGCCCTGAGCTGTAGG - Intergenic
1032589146 7:133176366-133176388 GTCTTGAACTCCTGAGCTCTAGG - Intergenic
1033137962 7:138800391-138800413 GTCCTGTTGTCTTGAGGTGTGGG - Intronic
1033365051 7:140666614-140666636 GTCCACTTGTCCTGAGCTGCCGG - Intronic
1034472979 7:151265512-151265534 GTCCTGAAGAGCAGAGCTGTGGG - Intronic
1035237145 7:157505652-157505674 TTCTTGTAGTCCAGATCTGTTGG + Intergenic
1035275734 7:157746873-157746895 GGCCTGTGTCCCTGAGCTGTGGG + Intronic
1035275755 7:157746996-157747018 GGCCTGTGTCCCTGAGCTGTGGG + Intronic
1035275777 7:157747119-157747141 GGCCTGTGTCCCTGAGCTGTGGG + Intronic
1035276028 7:157748431-157748453 GGCCTGTGTCCCTGAGCTGTGGG + Intronic
1035276099 7:157748841-157748863 GGCCTGTGTCCCTGAGCTGTGGG + Intronic
1035276200 7:157749374-157749396 GGCCTGTGTCCCTGAGCTGTGGG + Intronic
1035276216 7:157749456-157749478 GGCCTGTGTCCCTGAGCTGTGGG + Intronic
1036500931 8:9313325-9313347 GTCCTGAACTCCTGAGCTGAAGG + Intergenic
1037366595 8:18128932-18128954 GGCCTGGAGTCAGGAGCTGTGGG - Intergenic
1037452733 8:19033025-19033047 GTCTTGAAGTCCTGAGCTCAAGG - Intronic
1037707162 8:21324999-21325021 GTCTTTTAGCCCTGAGCTTTAGG - Intergenic
1037852809 8:22346481-22346503 TTCCAGTTGTCCTGAGTTGTAGG + Intronic
1041290243 8:56301868-56301890 GTCCTGTAGGCATGCGCTTTGGG + Intronic
1047970034 8:130076736-130076758 GTCTTGTACTCCTGAGCTCGTGG + Intronic
1048851733 8:138651968-138651990 TTCCTGAAGACCAGAGCTGTCGG + Intronic
1049326287 8:142023199-142023221 GACCTCTAGGACTGAGCTGTGGG - Intergenic
1052995138 9:34547875-34547897 GTCCTGTGGCTCTGGGCTGTGGG + Intergenic
1057629920 9:96711206-96711228 GTCCTGTGATCCTGGGTTGTGGG + Intergenic
1061388158 9:130302651-130302673 GTCCTGTTGTCCTGAGGAGCTGG - Intronic
1061794614 9:133078745-133078767 GTCCACTCGTCCTGAGCTGCCGG + Intronic
1062214310 9:135380825-135380847 GTTCTGAAGGCCTGAGCTGAGGG + Intergenic
1062246964 9:135574106-135574128 GTCCTGAAGGTCAGAGCTGTGGG + Intergenic
1187621463 X:21061051-21061073 GTCCCCTAGGCCTGAACTGTTGG - Intergenic
1187729396 X:22237654-22237676 TTTCTGAAGTCCTGAGCAGTTGG - Intronic
1189291637 X:39890093-39890115 GTCCTGAACTCCTGAGCTCAAGG - Intergenic
1189437367 X:41005124-41005146 GTCTTGAACTCCTGAGCTCTAGG - Intergenic
1190710270 X:53063025-53063047 GTCCTGTAGTTCTGTGGTCTTGG + Intronic
1190777402 X:53564096-53564118 GGCCTGTGGTCCTAAGCTGCTGG - Intronic
1193724134 X:85020479-85020501 GACCTGGAGTCTGGAGCTGTGGG - Intronic
1194464816 X:94220468-94220490 GTGCTTTAGTCCTGAACTATTGG + Intergenic
1194893878 X:99415371-99415393 GTCCAGGGGTACTGAGCTGTGGG - Intergenic
1195135713 X:101906135-101906157 GTCCTGAAGTCTGGGGCTGTGGG - Intronic
1196684310 X:118496874-118496896 ATCCCCCAGTCCTGAGCTGTGGG - Intronic
1197402332 X:126006793-126006815 GTCCTGCAGTCATGGGCTGGAGG - Intergenic
1200761810 Y:7045577-7045599 GTGCCGTAGTTCTGAGCTATTGG + Intronic
1201275178 Y:12290215-12290237 TTGCTGCACTCCTGAGCTGTGGG - Intergenic