ID: 1076865569

View in Genome Browser
Species Human (GRCh38)
Location 10:133164743-133164765
Sequence CGTCCTGTAGTCCTGAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865569_1076865581 24 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865581 10:133164790-133164812 GTGGTCGTGGGGTTGTCTGCTGG No data
1076865569_1076865578 12 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865578 10:133164778-133164800 CCGACCTTGAGGGTGGTCGTGGG No data
1076865569_1076865574 5 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865574 10:133164771-133164793 ATAGCTCCCGACCTTGAGGGTGG No data
1076865569_1076865576 11 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865576 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
1076865569_1076865572 1 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865572 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data
1076865569_1076865582 25 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865582 10:133164791-133164813 TGGTCGTGGGGTTGTCTGCTGGG No data
1076865569_1076865573 2 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG No data
1076865569_1076865579 13 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865579 10:133164779-133164801 CGACCTTGAGGGTGGTCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865569 Original CRISPR CGTCCTGTAGTCCTGAGCTG TGG (reversed) Intronic
No off target data available for this crispr