ID: 1076865570

View in Genome Browser
Species Human (GRCh38)
Location 10:133164766-133164788
Sequence CTCAAGGTCGGGAGCTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865570_1076865587 14 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865587 10:133164803-133164825 TGTCTGCTGGGATGTGGCGGGGG No data
1076865570_1076865585 12 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865585 10:133164801-133164823 GTTGTCTGCTGGGATGTGGCGGG No data
1076865570_1076865590 30 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865590 10:133164819-133164841 GCGGGGGGAGCCCAAGGACGTGG No data
1076865570_1076865584 11 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865584 10:133164800-133164822 GGTTGTCTGCTGGGATGTGGCGG No data
1076865570_1076865583 8 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865583 10:133164797-133164819 TGGGGTTGTCTGCTGGGATGTGG No data
1076865570_1076865579 -10 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865579 10:133164779-133164801 CGACCTTGAGGGTGGTCGTGGGG No data
1076865570_1076865588 15 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865588 10:133164804-133164826 GTCTGCTGGGATGTGGCGGGGGG No data
1076865570_1076865582 2 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865582 10:133164791-133164813 TGGTCGTGGGGTTGTCTGCTGGG No data
1076865570_1076865581 1 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865581 10:133164790-133164812 GTGGTCGTGGGGTTGTCTGCTGG No data
1076865570_1076865586 13 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865586 10:133164802-133164824 TTGTCTGCTGGGATGTGGCGGGG No data
1076865570_1076865589 24 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865589 10:133164813-133164835 GATGTGGCGGGGGGAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865570 Original CRISPR CTCAAGGTCGGGAGCTATCT GGG (reversed) Intronic