ID: 1076865572

View in Genome Browser
Species Human (GRCh38)
Location 10:133164767-133164789
Sequence CCAGATAGCTCCCGACCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865562_1076865572 28 Left 1076865562 10:133164716-133164738 CCCCTTCTGGAGGTGACTACAGG No data
Right 1076865572 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data
1076865565_1076865572 26 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC No data
Right 1076865572 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data
1076865564_1076865572 27 Left 1076865564 10:133164717-133164739 CCCTTCTGGAGGTGACTACAGGA No data
Right 1076865572 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data
1076865568_1076865572 2 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC No data
Right 1076865572 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data
1076865569_1076865572 1 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865572 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865572 Original CRISPR CCAGATAGCTCCCGACCTTG AGG Intronic