ID: 1076865573

View in Genome Browser
Species Human (GRCh38)
Location 10:133164768-133164790
Sequence CAGATAGCTCCCGACCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865569_1076865573 2 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG No data
1076865562_1076865573 29 Left 1076865562 10:133164716-133164738 CCCCTTCTGGAGGTGACTACAGG 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG No data
1076865565_1076865573 27 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG No data
1076865564_1076865573 28 Left 1076865564 10:133164717-133164739 CCCTTCTGGAGGTGACTACAGGA 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG No data
1076865568_1076865573 3 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865573 10:133164768-133164790 CAGATAGCTCCCGACCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865573 Original CRISPR CAGATAGCTCCCGACCTTGA GGG Intronic
No off target data available for this crispr