ID: 1076865574

View in Genome Browser
Species Human (GRCh38)
Location 10:133164771-133164793
Sequence ATAGCTCCCGACCTTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865569_1076865574 5 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865574 10:133164771-133164793 ATAGCTCCCGACCTTGAGGGTGG No data
1076865565_1076865574 30 Left 1076865565 10:133164718-133164740 CCTTCTGGAGGTGACTACAGGAC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1076865574 10:133164771-133164793 ATAGCTCCCGACCTTGAGGGTGG No data
1076865568_1076865574 6 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865574 10:133164771-133164793 ATAGCTCCCGACCTTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865574 Original CRISPR ATAGCTCCCGACCTTGAGGG TGG Intronic
No off target data available for this crispr