ID: 1076865575

View in Genome Browser
Species Human (GRCh38)
Location 10:133164777-133164799
Sequence CCACGACCACCCTCAAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865575_1076865587 3 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865587 10:133164803-133164825 TGTCTGCTGGGATGTGGCGGGGG No data
1076865575_1076865582 -9 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865582 10:133164791-133164813 TGGTCGTGGGGTTGTCTGCTGGG No data
1076865575_1076865585 1 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865585 10:133164801-133164823 GTTGTCTGCTGGGATGTGGCGGG No data
1076865575_1076865584 0 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865584 10:133164800-133164822 GGTTGTCTGCTGGGATGTGGCGG No data
1076865575_1076865593 29 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865593 10:133164829-133164851 CCCAAGGACGTGGGATCCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 151
1076865575_1076865589 13 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865589 10:133164813-133164835 GATGTGGCGGGGGGAGCCCAAGG No data
1076865575_1076865583 -3 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865583 10:133164797-133164819 TGGGGTTGTCTGCTGGGATGTGG No data
1076865575_1076865581 -10 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865581 10:133164790-133164812 GTGGTCGTGGGGTTGTCTGCTGG No data
1076865575_1076865590 19 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865590 10:133164819-133164841 GCGGGGGGAGCCCAAGGACGTGG No data
1076865575_1076865588 4 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865588 10:133164804-133164826 GTCTGCTGGGATGTGGCGGGGGG No data
1076865575_1076865586 2 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865586 10:133164802-133164824 TTGTCTGCTGGGATGTGGCGGGG No data
1076865575_1076865591 20 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865591 10:133164820-133164842 CGGGGGGAGCCCAAGGACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865575 Original CRISPR CCACGACCACCCTCAAGGTC GGG (reversed) Intronic