ID: 1076865576

View in Genome Browser
Species Human (GRCh38)
Location 10:133164777-133164799
Sequence CCCGACCTTGAGGGTGGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865568_1076865576 12 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865576 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
1076865569_1076865576 11 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865576 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865576 Original CRISPR CCCGACCTTGAGGGTGGTCG TGG Intronic
No off target data available for this crispr