ID: 1076865578

View in Genome Browser
Species Human (GRCh38)
Location 10:133164778-133164800
Sequence CCGACCTTGAGGGTGGTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865569_1076865578 12 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865578 10:133164778-133164800 CCGACCTTGAGGGTGGTCGTGGG No data
1076865568_1076865578 13 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC No data
Right 1076865578 10:133164778-133164800 CCGACCTTGAGGGTGGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865578 Original CRISPR CCGACCTTGAGGGTGGTCGT GGG Intronic