ID: 1076865581

View in Genome Browser
Species Human (GRCh38)
Location 10:133164790-133164812
Sequence GTGGTCGTGGGGTTGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865570_1076865581 1 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG No data
Right 1076865581 10:133164790-133164812 GTGGTCGTGGGGTTGTCTGCTGG No data
1076865571_1076865581 0 Left 1076865571 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG No data
Right 1076865581 10:133164790-133164812 GTGGTCGTGGGGTTGTCTGCTGG No data
1076865568_1076865581 25 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC No data
Right 1076865581 10:133164790-133164812 GTGGTCGTGGGGTTGTCTGCTGG No data
1076865575_1076865581 -10 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865581 10:133164790-133164812 GTGGTCGTGGGGTTGTCTGCTGG No data
1076865569_1076865581 24 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865581 10:133164790-133164812 GTGGTCGTGGGGTTGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865581 Original CRISPR GTGGTCGTGGGGTTGTCTGC TGG Intronic