ID: 1076865582

View in Genome Browser
Species Human (GRCh38)
Location 10:133164791-133164813
Sequence TGGTCGTGGGGTTGTCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865571_1076865582 1 Left 1076865571 10:133164767-133164789 CCAGATAGCTCCCGACCTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1076865582 10:133164791-133164813 TGGTCGTGGGGTTGTCTGCTGGG No data
1076865575_1076865582 -9 Left 1076865575 10:133164777-133164799 CCCGACCTTGAGGGTGGTCGTGG No data
Right 1076865582 10:133164791-133164813 TGGTCGTGGGGTTGTCTGCTGGG No data
1076865570_1076865582 2 Left 1076865570 10:133164766-133164788 CCCAGATAGCTCCCGACCTTGAG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1076865582 10:133164791-133164813 TGGTCGTGGGGTTGTCTGCTGGG No data
1076865568_1076865582 26 Left 1076865568 10:133164742-133164764 CCCACAGCTCAGGACTACAGGAC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1076865582 10:133164791-133164813 TGGTCGTGGGGTTGTCTGCTGGG No data
1076865577_1076865582 -10 Left 1076865577 10:133164778-133164800 CCGACCTTGAGGGTGGTCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1076865582 10:133164791-133164813 TGGTCGTGGGGTTGTCTGCTGGG No data
1076865569_1076865582 25 Left 1076865569 10:133164743-133164765 CCACAGCTCAGGACTACAGGACG No data
Right 1076865582 10:133164791-133164813 TGGTCGTGGGGTTGTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865582 Original CRISPR TGGTCGTGGGGTTGTCTGCT GGG Intronic
No off target data available for this crispr