ID: 1076865630

View in Genome Browser
Species Human (GRCh38)
Location 10:133164982-133165004
Sequence CAGAGCAGGGTGGAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076865618_1076865630 26 Left 1076865618 10:133164933-133164955 CCAGCCAGTGTGGATTCGGGCAA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1076865630 10:133164982-133165004 CAGAGCAGGGTGGAGGCTGCAGG No data
1076865620_1076865630 22 Left 1076865620 10:133164937-133164959 CCAGTGTGGATTCGGGCAAGGAG 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1076865630 10:133164982-133165004 CAGAGCAGGGTGGAGGCTGCAGG No data
1076865623_1076865630 -9 Left 1076865623 10:133164968-133164990 CCTCTCACCTGTGCCAGAGCAGG 0: 1
1: 0
2: 2
3: 39
4: 328
Right 1076865630 10:133164982-133165004 CAGAGCAGGGTGGAGGCTGCAGG No data
1076865617_1076865630 27 Left 1076865617 10:133164932-133164954 CCCAGCCAGTGTGGATTCGGGCA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1076865630 10:133164982-133165004 CAGAGCAGGGTGGAGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076865630 Original CRISPR CAGAGCAGGGTGGAGGCTGC AGG Intronic
No off target data available for this crispr