ID: 1076868732

View in Genome Browser
Species Human (GRCh38)
Location 10:133182357-133182379
Sequence GTGGACACGCACCTGCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076868732_1076868742 23 Left 1076868732 10:133182357-133182379 CCAGGATGCAGGTGCGTGTCCAC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1076868742 10:133182403-133182425 ACACTTGGGAGCACAGGTGCGGG No data
1076868732_1076868738 8 Left 1076868732 10:133182357-133182379 CCAGGATGCAGGTGCGTGTCCAC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1076868738 10:133182388-133182410 CCTGGACTAGAGTGGACACTTGG No data
1076868732_1076868741 22 Left 1076868732 10:133182357-133182379 CCAGGATGCAGGTGCGTGTCCAC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1076868741 10:133182402-133182424 GACACTTGGGAGCACAGGTGCGG No data
1076868732_1076868735 0 Left 1076868732 10:133182357-133182379 CCAGGATGCAGGTGCGTGTCCAC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1076868735 10:133182380-133182402 TCAGCCAGCCTGGACTAGAGTGG No data
1076868732_1076868740 17 Left 1076868732 10:133182357-133182379 CCAGGATGCAGGTGCGTGTCCAC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1076868740 10:133182397-133182419 GAGTGGACACTTGGGAGCACAGG No data
1076868732_1076868744 25 Left 1076868732 10:133182357-133182379 CCAGGATGCAGGTGCGTGTCCAC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1076868744 10:133182405-133182427 ACTTGGGAGCACAGGTGCGGGGG No data
1076868732_1076868743 24 Left 1076868732 10:133182357-133182379 CCAGGATGCAGGTGCGTGTCCAC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1076868743 10:133182404-133182426 CACTTGGGAGCACAGGTGCGGGG No data
1076868732_1076868733 -10 Left 1076868732 10:133182357-133182379 CCAGGATGCAGGTGCGTGTCCAC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1076868733 10:133182370-133182392 GCGTGTCCACTCAGCCAGCCTGG No data
1076868732_1076868739 9 Left 1076868732 10:133182357-133182379 CCAGGATGCAGGTGCGTGTCCAC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1076868739 10:133182389-133182411 CTGGACTAGAGTGGACACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076868732 Original CRISPR GTGGACACGCACCTGCATCC TGG (reversed) Intronic
900534460 1:3170209-3170231 GTGGCCCTGCACCTGCAGCCTGG + Intronic
901588861 1:10322268-10322290 GTGGACAAGCACATGCACCCTGG + Intronic
901662231 1:10805767-10805789 GTGGACACACACATTCATACGGG - Intergenic
902437807 1:16409519-16409541 AGGGACAGGGACCTGCATCCGGG + Intronic
903808613 1:26022281-26022303 GGGGACACGGCCCTGCATTCTGG + Exonic
905447488 1:38036502-38036524 GTGCCCAGGTACCTGCATCCAGG - Intergenic
906214873 1:44032860-44032882 GTGCACACACACCTGGATCTAGG + Intergenic
915736228 1:158087303-158087325 GTGGACCTGGACCTGCTTCCTGG + Intronic
918512957 1:185331293-185331315 GTGGACAGACACCTGCAGCGAGG + Intergenic
1063547213 10:6993005-6993027 GTGGACAAGAACCTGTATCGTGG + Intergenic
1068521771 10:58085047-58085069 GTGGACAGGCAACAGCATCAGGG - Intergenic
1069940214 10:71950204-71950226 TTGGACCAGCACCTGCACCCTGG - Intergenic
1070166855 10:73905470-73905492 CTGCACACACACCTGCCTCCAGG + Intergenic
1070963444 10:80515327-80515349 GAGGACAGCCACCTGCAGCCAGG - Intronic
1075723954 10:124602416-124602438 GAGGAGCCTCACCTGCATCCCGG + Intronic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1076868726 10:133182325-133182347 GTGGACATGCACCTGCGTCCTGG - Intronic
1076868732 10:133182357-133182379 GTGGACACGCACCTGCATCCTGG - Intronic
1083186434 11:61020417-61020439 GTGCACACACACATGCAGCCTGG - Intergenic
1083777434 11:64901052-64901074 GTGGTGACACAGCTGCATCCCGG - Exonic
1084218707 11:67665184-67665206 CTGGACTCGCACCTGAAACCCGG - Intronic
1084572850 11:69969980-69970002 CTGGCCATGCTCCTGCATCCAGG - Intergenic
1088805786 11:113350837-113350859 GTGGAGATGCGCATGCATCCAGG + Intronic
1089650438 11:119909387-119909409 ATGGCCATGCCCCTGCATCCAGG + Intergenic
1102191866 12:110994820-110994842 GTGGACAGCCACCTGCTTGCTGG + Intergenic
1103166976 12:118778635-118778657 GTAGGCAGGCACCTGCATGCAGG + Intergenic
1104256681 12:127145930-127145952 ATGGCCACGCACCTGCAGCAGGG + Intergenic
1108867206 13:54938153-54938175 CTGCACAGGCACCTGCACCCTGG - Intergenic
1113937727 13:114003270-114003292 GTGGAGCCTCAGCTGCATCCAGG + Intronic
1116869718 14:50059786-50059808 GTGGCCATGCATCTGCAGCCTGG - Intergenic
1121115875 14:91342364-91342386 GAGGCCACGCACCTACCTCCTGG + Exonic
1122718034 14:103706991-103707013 GTGGCCACTCACCAGCCTCCAGG + Exonic
1122853266 14:104548030-104548052 CTGTACACACATCTGCATCCAGG + Intronic
1123161955 14:106287168-106287190 GCCGACACGCACCTGCAGTCTGG - Intergenic
1123179995 14:106460565-106460587 GCTGACACGCACCTGCAGTCTGG - Intergenic
1126570035 15:50141065-50141087 CTTGACCCGCACCTGCCTCCAGG + Intronic
1126812261 15:52419168-52419190 GTGTACATGCACCTGCACCTAGG + Intronic
1130519514 15:84651574-84651596 GGGAACACGCTCCTGCTTCCAGG - Intronic
1132878267 16:2149700-2149722 GAGGGCAGCCACCTGCATCCCGG - Intronic
1135895883 16:26402006-26402028 GTGGACAAGCACATGAATCAAGG - Intergenic
1137564277 16:49523612-49523634 GTGGGCACCCACCTGCAGCTCGG + Exonic
1143815201 17:9507135-9507157 GTGACTACGCTCCTGCATCCCGG + Intronic
1143885530 17:10062080-10062102 GTGGACATGCACCTGGGTCGGGG - Intronic
1147264462 17:39226137-39226159 CTGGTCACGCCCCTCCATCCCGG - Intergenic
1150170272 17:62986941-62986963 ATGGACATGCACCTGCAGTCAGG - Intergenic
1152378669 17:79931089-79931111 GTGGCCACCCACCTGCTCCCAGG - Intergenic
1152500389 17:80704532-80704554 GTGTACAAACAGCTGCATCCAGG - Intronic
1153626094 18:7023589-7023611 GGGGACATGCACCTGTTTCCAGG + Intronic
1157315914 18:46589473-46589495 GTGTCCACTCACCTGCATCCTGG - Intronic
1157727824 18:49978420-49978442 GTGGACACCTACCTGCATTGGGG - Intronic
1157785084 18:50474380-50474402 TTGCACCTGCACCTGCATCCTGG + Intergenic
1158857222 18:61554702-61554724 TTGGACGCGCGCCTGCCTCCTGG - Exonic
1159721694 18:71899128-71899150 GTGGACAGGCACCAGCATACTGG - Intergenic
1160856429 19:1220011-1220033 GAGGCCACAGACCTGCATCCAGG - Intronic
1160888361 19:1363134-1363156 CTGCACACGCACCAGCTTCCTGG - Intronic
1162525519 19:11204044-11204066 GTGGACAGCCACCTGCCTCTGGG - Intronic
1162685611 19:12381282-12381304 GTGAACAAGCACATGCCTCCTGG - Exonic
1164679593 19:30124833-30124855 GTGTACACACATCTGCTTCCTGG + Intergenic
1168130552 19:54315990-54316012 GGGGCCACGCACCTGCTCCCTGG - Intergenic
1168420318 19:56197722-56197744 CTGGACACTCACCTCCTTCCCGG + Exonic
1168424525 19:56228240-56228262 CTGGACACTCACCTCCTTCCCGG + Exonic
925356335 2:3244085-3244107 GTGCTCTCCCACCTGCATCCTGG - Intronic
926082816 2:10002771-10002793 GTGGAGACTCTCCTGCAGCCTGG + Intergenic
937903724 2:127041504-127041526 GTGGAGATGCACCAGCTTCCGGG + Intergenic
1175640418 20:60624925-60624947 TGGGACACTCAACTGCATCCTGG - Intergenic
1177411133 21:20732019-20732041 GTTGTCACGCACATGCATACAGG + Intergenic
1177725995 21:24968832-24968854 GGTGACACCAACCTGCATCCAGG + Intergenic
1180246985 21:46554923-46554945 GAGGACACGCACCTGTGTCTAGG - Exonic
1181008587 22:20026802-20026824 GTTGCCACTCACCTGCCTCCAGG - Intronic
1184857347 22:47153646-47153668 CTGCAAACGCACCTGCTTCCCGG - Intronic
1185106313 22:48871820-48871842 GTGCACATGCACCTGCTCCCTGG + Intergenic
1185347333 22:50316358-50316380 ATGGCCACTCACCTGCTTCCAGG + Exonic
949635203 3:5974829-5974851 GTAGACACGCAGCTGCATTGAGG + Intergenic
952838110 3:37621428-37621450 GTGGCCAGGTACCGGCATCCAGG - Intronic
952924910 3:38313694-38313716 GTGCACGCGCACTTGCCTCCTGG + Intronic
954678009 3:52326251-52326273 CTGGAAAGGCACCTGCATCTTGG - Exonic
961501695 3:127340781-127340803 GTGGGCTCGCTCATGCATCCGGG - Intergenic
962361708 3:134748655-134748677 CTGGACACACACCAGCATACAGG - Intronic
962423021 3:135244597-135244619 GTGGAAAAGCACCTTCATTCTGG - Intronic
963112279 3:141697607-141697629 CTGGAGAGGCACCTGCACCCTGG - Intergenic
968916314 4:3498490-3498512 CTGGACACCCCCCTGCAGCCTGG - Intronic
968957587 4:3727091-3727113 GGGGACACCCACCAGCATCCCGG - Intergenic
969663228 4:8542572-8542594 ATGCACACGCACTTGCACCCAGG - Intergenic
981511890 4:145566569-145566591 GTGCACACGCACATGCCTGCTGG - Intergenic
985660440 5:1154559-1154581 GTGGACACTCACATGGCTCCCGG + Intergenic
985915894 5:2919052-2919074 GAGGATACGCACGTGCACCCTGG + Intergenic
986845933 5:11753489-11753511 GTTGAAACAAACCTGCATCCAGG + Intronic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
992672934 5:79077602-79077624 GTGGACACCAACCTGCGTCTGGG - Exonic
996855180 5:127997880-127997902 GAGGACATGCACCTGTGTCCTGG - Intergenic
997190649 5:131931689-131931711 GTCGACAGGCGCCTGCATCCTGG - Intronic
997527786 5:134564589-134564611 ATGCACAGGCACCTGCATCCAGG + Exonic
1007056516 6:38891452-38891474 GTGGGCACGCACTTGTCTCCTGG + Intronic
1007626228 6:43247742-43247764 GTGGAGACCCGCCTGCACCCGGG - Intronic
1008300726 6:49835968-49835990 ATGTGCACGCACCTACATCCTGG + Intronic
1010172086 6:72986652-72986674 ATGGCCAAGCACCTGCTTCCTGG - Intronic
1011253082 6:85393525-85393547 TTGGAAACACACCTGCCTCCTGG - Intergenic
1016991116 6:149929218-149929240 GCAGACACTCACCTGCACCCAGG + Intergenic
1016993035 6:149942657-149942679 GTAGACACTCACCTGCACCCAGG + Intronic
1017002187 6:150004534-150004556 GCAGACACTCACCTGCACCCAGG - Intergenic
1017005301 6:150024867-150024889 GTAGACACTCACCTGCACCCAGG - Intronic
1017006219 6:150029495-150029517 GCAGACACTTACCTGCATCCAGG + Intergenic
1018252049 6:161881217-161881239 GTGGAGACGCATCAGCAGCCAGG + Intronic
1018969354 6:168515558-168515580 GCAGCCTCGCACCTGCATCCTGG + Intronic
1018977647 6:168577606-168577628 GGTGACACGCACCCTCATCCTGG + Intronic
1019414043 7:919307-919329 GTGGCCACGCACTTCCATTCGGG - Intronic
1022198522 7:28093772-28093794 GTGGACAAGCATCTGCAGGCAGG - Intronic
1022726525 7:32986622-32986644 GTGGACAATCTCCTGCTTCCTGG + Intronic
1025047060 7:55701011-55701033 GTGGACAATCTCCTGCTTCCTGG - Intergenic
1026938914 7:74275446-74275468 AGGGACACGCACCTGCCTGCAGG + Intergenic
1030454858 7:109760604-109760626 GTGAACATGCACATGCATGCTGG + Intergenic
1032080211 7:128854902-128854924 GTGGACGCCCACCTGGTTCCTGG - Exonic
1036682303 8:10884376-10884398 GTGGTCATGAACCTGCATCTAGG + Intergenic
1040498857 8:47990202-47990224 CTGGACGGGCACCTGCACCCTGG - Intergenic
1047568502 8:126072885-126072907 GTGGCCAAGTACCTGCTTCCTGG - Intergenic
1047860230 8:128957921-128957943 GTGGTCATGCACATGCATTCAGG - Intergenic
1047934645 8:129764878-129764900 GTGGACCCCCACCTGCAGCAGGG - Intronic
1049256657 8:141617724-141617746 AGGGACACACACCTGCAGCCTGG - Intergenic
1049256674 8:141617806-141617828 AGGGACACACACCTGCAGCCTGG - Intergenic
1049424551 8:142532298-142532320 GGGGACACCAACCTGCTTCCCGG - Intronic
1049710047 8:144059365-144059387 GTGGCCCCACACCAGCATCCAGG + Intronic
1050537221 9:6641331-6641353 GTGGAAACGCAGCAGCTTCCTGG - Intronic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1061726168 9:132583017-132583039 TTGGACTCCCACCTGCAGCCCGG + Exonic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185642751 X:1597592-1597614 GTGGACAGGCACATTCAGCCAGG - Intronic
1189847268 X:45149161-45149183 GTGGAAACACACCTGGATGCAGG + Exonic
1198406278 X:136315804-136315826 GTGGACACACACATGCACACAGG + Intronic