ID: 1076870113

View in Genome Browser
Species Human (GRCh38)
Location 10:133188852-133188874
Sequence GAGCCGCCTGTTCCGTTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076870113_1076870123 23 Left 1076870113 10:133188852-133188874 CCGGTGAACGGAACAGGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1076870123 10:133188898-133188920 CCTGCTGGGTTGCAGCACCGAGG No data
1076870113_1076870120 9 Left 1076870113 10:133188852-133188874 CCGGTGAACGGAACAGGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1076870120 10:133188884-133188906 GCACCTTGTGGGTGCCTGCTGGG No data
1076870113_1076870115 -3 Left 1076870113 10:133188852-133188874 CCGGTGAACGGAACAGGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1076870115 10:133188872-133188894 CTCCCGTCTGGAGCACCTTGTGG No data
1076870113_1076870119 8 Left 1076870113 10:133188852-133188874 CCGGTGAACGGAACAGGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1076870119 10:133188883-133188905 AGCACCTTGTGGGTGCCTGCTGG No data
1076870113_1076870125 27 Left 1076870113 10:133188852-133188874 CCGGTGAACGGAACAGGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1076870125 10:133188902-133188924 CTGGGTTGCAGCACCGAGGGAGG No data
1076870113_1076870116 -2 Left 1076870113 10:133188852-133188874 CCGGTGAACGGAACAGGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1076870116 10:133188873-133188895 TCCCGTCTGGAGCACCTTGTGGG No data
1076870113_1076870124 24 Left 1076870113 10:133188852-133188874 CCGGTGAACGGAACAGGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1076870124 10:133188899-133188921 CTGCTGGGTTGCAGCACCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076870113 Original CRISPR GAGCCGCCTGTTCCGTTCAC CGG (reversed) Intronic
903331369 1:22598776-22598798 GAGGCGCCTGGTCCGTGAACAGG - Intronic
1062969528 10:1635662-1635684 GGCCAGCCAGTTCCGTTCACAGG - Intronic
1076870113 10:133188852-133188874 GAGCCGCCTGTTCCGTTCACCGG - Intronic
1080343277 11:31294111-31294133 GAGCTGCTTGTGCAGTTCACAGG + Intronic
1083899876 11:65638418-65638440 GAGCCGCCGCTTCCACTCACCGG - Intronic
1090657880 11:128859753-128859775 GAGCCGCCTGTGCTGGGCACTGG + Intronic
1092146277 12:6216796-6216818 CAGCCGCCTTCTCCGATCACAGG + Intronic
1105007394 12:132729690-132729712 GAGCCGCCTGGCCGGTTCCCTGG + Exonic
1105015361 12:132783449-132783471 GGGCCGCCTGTTCCACTCTCTGG - Intronic
1107707070 13:43118733-43118755 GTGCCTCCTGTTCATTTCACTGG - Intergenic
1123209491 14:106745608-106745630 GACCCGCCTGCTCCGCTCTCTGG + Intergenic
1133300299 16:4778306-4778328 GAGCCGCCTGTACCAGGCACTGG - Intronic
1138434486 16:56989502-56989524 CAGCCGCCAGTTCCATGCACTGG + Exonic
1160629148 18:80233309-80233331 GACCCGCCGGTTCCAGTCACCGG - Intronic
1161349235 19:3783269-3783291 CAGCATCCTGTTCCGTTCCCGGG + Intronic
930725777 2:54679991-54680013 GAGGTGCATGTTCAGTTCACCGG - Intergenic
947864537 2:233387067-233387089 GCGCTGCCTGTTCCATCCACCGG - Intronic
948071902 2:235134852-235134874 TAGGTGCCTGTTCCCTTCACTGG + Intergenic
1184396134 22:44242580-44242602 GAGCTGTCTGTTCTGTTCATTGG + Intergenic
1184699822 22:46163145-46163167 GAGCCGCACATTCCGTTCACTGG - Intronic
1184888743 22:47366630-47366652 GAGCCACCTGCTCCGTCCTCTGG - Intergenic
955447898 3:59032991-59033013 TTGCCGCCTGTTCCTTTCTCTGG - Intronic
957367531 3:79245710-79245732 AAACTGCCTGTTCCTTTCACTGG + Intronic
960941713 3:122939292-122939314 GAGCCACTTGTTCTTTTCACTGG - Intronic
961527050 3:127510940-127510962 GAGATGCCTGTTCAGTTCAGAGG - Intergenic
991732776 5:69605166-69605188 GAGCTGACTGTCCCGTGCACGGG - Intergenic
991809209 5:70460310-70460332 GAGCTGACTGTCCCGTGCACGGG - Intergenic
991862177 5:71022686-71022708 GAGCTGACTGTCCCGTGCACGGG + Intronic
998419282 5:141969102-141969124 GCGCCGCCTCTTCCGTTCTCGGG - Exonic
1028585477 7:92447579-92447601 CAGCGGCCTGGTCCTTTCACCGG + Exonic
1034902635 7:154916715-154916737 GAGCCCCCTGCTCTGTCCACAGG + Intergenic
1055400205 9:75915306-75915328 GAGCAGCCTGTTCTGTTTATGGG + Intronic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1059716423 9:116917397-116917419 GAGCCCCCCGTTCCATGCACAGG + Intronic
1060656401 9:125375331-125375353 GAGCCACCTGTCCCATTCTCTGG + Intergenic
1061016466 9:127983606-127983628 GAGCTGCCTATTCCTTTCACAGG - Intergenic
1190288200 X:48974312-48974334 GAGCAGCCTGTCCCCTTCTCTGG - Intronic