ID: 1076871039

View in Genome Browser
Species Human (GRCh38)
Location 10:133195303-133195325
Sequence GGCTCCCGGGTCCGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076871026_1076871039 15 Left 1076871026 10:133195265-133195287 CCAGTCGGGGGGCTTCCGGGAGC 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1076871039 10:133195303-133195325 GGCTCCCGGGTCCGTGAGGTGGG No data
1076871030_1076871039 0 Left 1076871030 10:133195280-133195302 CCGGGAGCAGGCACCAGTCGGGG 0: 1
1: 0
2: 0
3: 12
4: 140
Right 1076871039 10:133195303-133195325 GGCTCCCGGGTCCGTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076871039 Original CRISPR GGCTCCCGGGTCCGTGAGGT GGG Intronic
No off target data available for this crispr