ID: 1076872440

View in Genome Browser
Species Human (GRCh38)
Location 10:133200570-133200592
Sequence CAGCGGGGCTGCCTTTGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 241}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076872435_1076872440 -5 Left 1076872435 10:133200552-133200574 CCTCAGACTGCACTGCTCCAGCG 0: 1
1: 0
2: 0
3: 20
4: 188
Right 1076872440 10:133200570-133200592 CAGCGGGGCTGCCTTTGCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 241
1076872434_1076872440 2 Left 1076872434 10:133200545-133200567 CCAGCAGCCTCAGACTGCACTGC 0: 1
1: 0
2: 2
3: 41
4: 332
Right 1076872440 10:133200570-133200592 CAGCGGGGCTGCCTTTGCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 241
1076872433_1076872440 3 Left 1076872433 10:133200544-133200566 CCCAGCAGCCTCAGACTGCACTG 0: 1
1: 0
2: 1
3: 25
4: 440
Right 1076872440 10:133200570-133200592 CAGCGGGGCTGCCTTTGCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 241
1076872432_1076872440 10 Left 1076872432 10:133200537-133200559 CCAGGGTCCCAGCAGCCTCAGAC 0: 1
1: 0
2: 0
3: 44
4: 509
Right 1076872440 10:133200570-133200592 CAGCGGGGCTGCCTTTGCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 241
1076872430_1076872440 12 Left 1076872430 10:133200535-133200557 CCCCAGGGTCCCAGCAGCCTCAG 0: 1
1: 0
2: 6
3: 60
4: 561
Right 1076872440 10:133200570-133200592 CAGCGGGGCTGCCTTTGCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 241
1076872431_1076872440 11 Left 1076872431 10:133200536-133200558 CCCAGGGTCCCAGCAGCCTCAGA 0: 1
1: 1
2: 3
3: 34
4: 388
Right 1076872440 10:133200570-133200592 CAGCGGGGCTGCCTTTGCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076872440 Original CRISPR CAGCGGGGCTGCCTTTGCCC CGG Intronic