ID: 1076874040

View in Genome Browser
Species Human (GRCh38)
Location 10:133207304-133207326
Sequence CCTGCAGGCCGGCACGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076874033_1076874040 3 Left 1076874033 10:133207278-133207300 CCGGGCGGCCGGCAGAAGGCCCG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1076874040 10:133207304-133207326 CCTGCAGGCCGGCACGCCGCTGG 0: 1
1: 0
2: 0
3: 16
4: 165
1076874032_1076874040 4 Left 1076874032 10:133207277-133207299 CCCGGGCGGCCGGCAGAAGGCCC 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1076874040 10:133207304-133207326 CCTGCAGGCCGGCACGCCGCTGG 0: 1
1: 0
2: 0
3: 16
4: 165
1076874034_1076874040 -5 Left 1076874034 10:133207286-133207308 CCGGCAGAAGGCCCGCATCCTGC 0: 1
1: 0
2: 3
3: 20
4: 164
Right 1076874040 10:133207304-133207326 CCTGCAGGCCGGCACGCCGCTGG 0: 1
1: 0
2: 0
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076874040 Original CRISPR CCTGCAGGCCGGCACGCCGC TGG Exonic
901060813 1:6471145-6471167 CCTGCGGGCCGGCCCGCGCCAGG + Intronic
901810019 1:11762207-11762229 CCCGCAGGTCGGCAGGTCGCGGG - Exonic
903754568 1:25651945-25651967 CCGGCAGGCAGGCAGGCAGCAGG - Intronic
916057789 1:161079934-161079956 CCTGCAGGCCGGTGCCCCGCGGG - Exonic
921703608 1:218294585-218294607 CCTGCAGGACGGCACACCCAGGG - Intronic
922675380 1:227546204-227546226 CCTGCAGGCAGGCCCACCTCAGG - Intergenic
922680714 1:227593071-227593093 CCTGAAGTCCGGCACCCTGCGGG - Intronic
1063432092 10:5999689-5999711 CCTGCAGACCCGCAGGCAGCTGG - Intergenic
1069795929 10:71051683-71051705 CCAGCAGGCTGGCAGGCAGCTGG + Intergenic
1070627556 10:78062007-78062029 CCTGCAGGTCGGCAGGCACCCGG + Intergenic
1071283033 10:84120097-84120119 CCTGAAGTCTGGCACCCCGCGGG - Intergenic
1074399084 10:113126892-113126914 CCTGCCCGCCCGCCCGCCGCCGG - Intronic
1075031930 10:119029711-119029733 CCTGCCCGCCGGCCTGCCGCGGG - Exonic
1076344126 10:129768867-129768889 CCGGCAGGCATGCACGCTGCAGG + Intergenic
1076874040 10:133207304-133207326 CCTGCAGGCCGGCACGCCGCTGG + Exonic
1076947877 10:133664653-133664675 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1076948867 10:133667963-133667985 CCGGCAGGCCGTCGCGCTGCGGG - Exonic
1076949851 10:133671262-133671284 CCGGCAGGCCGTCGCGCTGCGGG - Intronic
1076950835 10:133674561-133674583 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1076951825 10:133677871-133677893 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1076952814 10:133681181-133681203 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1076953798 10:133684480-133684502 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1076954782 10:133740832-133740854 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1076955771 10:133744142-133744164 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1076956761 10:133747452-133747474 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1076957748 10:133750761-133750783 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1076958733 10:133754060-133754082 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1076959722 10:133757370-133757392 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1076960706 10:133760669-133760691 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1077194445 11:1272291-1272313 GCTGCAGGCCGGGGCGCCGCGGG - Intergenic
1077304929 11:1864759-1864781 TCTGCAGGCCGGCTCCCTGCAGG - Intronic
1077361901 11:2144542-2144564 GGTGCAGGGCTGCACGCCGCTGG + Intronic
1077489819 11:2855622-2855644 CCCGCAGGCCCCCACGCCGCAGG - Intergenic
1078151881 11:8766455-8766477 CCTGCTGGCCGGCAGGCTTCTGG - Intronic
1079128637 11:17735294-17735316 CGGGCAGGCGGGCCCGCCGCCGG + Exonic
1083387777 11:62324669-62324691 CCTGAAGGCAGGCCAGCCGCTGG + Intergenic
1083758382 11:64803153-64803175 CCTGCCGGCCCGCCCGGCGCCGG - Exonic
1083776194 11:64895325-64895347 CCCGCAGGTCGGCAGGCTGCTGG + Exonic
1084268452 11:68016803-68016825 CATGAAGGCCGGCAGGCGGCCGG - Intronic
1086552534 11:88069305-88069327 CCTGCAGCCCGCCATGCCGGAGG + Intergenic
1088428386 11:109730009-109730031 CCTGCAGGCTCACACTCCGCAGG + Intergenic
1090381720 11:126332111-126332133 CCTGCAGGCCGGTTTGCCGCAGG - Intronic
1097357316 12:58616193-58616215 CCTGGAGGCTGGCAAGCCTCTGG + Intronic
1102029279 12:109730690-109730712 CCTGCAGCCTGGCACACCACAGG + Intronic
1103348270 12:120265470-120265492 CCTGCCGGCCGGGGCTCCGCGGG - Intronic
1103520859 12:121536492-121536514 CCTTCAGGCGGGGACCCCGCTGG - Intronic
1103968539 12:124655230-124655252 GCAGCAGGCCAGCACGGCGCCGG - Intergenic
1104713679 12:131003250-131003272 CCTGCACGGCAGCACGCCCCAGG + Exonic
1106112048 13:26785958-26785980 CCTGCATGCCGGCAGGCCACCGG - Intergenic
1112392358 13:98997195-98997217 CCTGCAGGCCCACACGTCTCAGG + Intronic
1112494804 13:99896155-99896177 CCTGCTCGCCCGCCCGCCGCGGG + Exonic
1113085582 13:106567208-106567230 TCTGCAGGCCGGCTCGCTCCCGG + Intronic
1113126741 13:106987600-106987622 CCAGCTGGCCGGCACACCCCGGG - Intergenic
1113378052 13:109782672-109782694 CCTGCAGGCCAGCCAGCCCCCGG - Exonic
1121595229 14:95157229-95157251 CCTGCAGCACGGGGCGCCGCGGG + Intronic
1122265009 14:100542444-100542466 CGTGAAGGCCGGCATGCCGGCGG - Intronic
1122812733 14:104297045-104297067 ACTGCAGGCAGGCACGCTTCTGG - Intergenic
1123038077 14:105479341-105479363 CGTGCAGGCCGGCTCGCCGTGGG - Intronic
1202853697 14_GL000225v1_random:37172-37194 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
1202856252 14_GL000225v1_random:53636-53658 CCGGCAGGCCGTCACGCTGTGGG - Intergenic
1125757050 15:42071243-42071265 GCTGCAGCCAGGCACGGCGCTGG - Exonic
1128111219 15:65077397-65077419 CCTGGAGGCCAGCACGTTGCTGG + Exonic
1128153661 15:65378229-65378251 GCTGCAGCCCGGGACGGCGCCGG - Intergenic
1129189021 15:73927008-73927030 GCTGCTGGCCGGCGCGCCCCAGG + Exonic
1132204982 15:99980353-99980375 CCTGCAGGTCGGCAGGCAGCAGG - Intronic
1132535538 16:477613-477635 CCTGCAGGACGGCAGGGCCCAGG - Intronic
1132974019 16:2702665-2702687 CATGCAGGCTGGGAGGCCGCAGG - Intronic
1139825613 16:69754847-69754869 CCTGCAGAGCCGCATGCCGCAGG + Exonic
1142000534 16:87661731-87661753 CCCGCAGGCCGCCACGGGGCGGG + Intronic
1142178135 16:88654411-88654433 CCTGCAGCTCGGGACCCCGCAGG - Intronic
1143608342 17:8003435-8003457 TCGGCTGGCCGGCAGGCCGCAGG - Exonic
1144994927 17:19261099-19261121 CCTGCAGGGTGGCATCCCGCAGG + Intronic
1145996990 17:29110531-29110553 CCTGGAGGGCGGCTCGCAGCTGG - Exonic
1149512625 17:57256253-57256275 CCTCCGGGCCGGCAGGGCGCAGG - Intronic
1151224850 17:72640536-72640558 CCTGCAGGGCGGCCGGCCGGCGG - Intergenic
1151556497 17:74849495-74849517 CCAGCAGGCAGGCTCGCCTCAGG - Intronic
1151900213 17:77007436-77007458 CCTGCAGGCCGGACCCCTGCCGG + Intergenic
1152301184 17:79495884-79495906 CCTGCAGGCCGGGACCCTGCAGG + Intronic
1152640876 17:81448725-81448747 GCTGCTGGCCCGCACGCGGCAGG + Intronic
1152677225 17:81647918-81647940 GCTGCAGGCCTGCACCCCGGGGG - Exonic
1152861594 17:82699202-82699224 CCCGCAGGCCGCCTCGCCGGAGG + Intergenic
1153971755 18:10233629-10233651 CCTGCAGCACAGCACACCGCTGG - Intergenic
1154123470 18:11670106-11670128 CCAGCAGGGCTGCACGCCACAGG - Intergenic
1154218549 18:12433109-12433131 CGTGCTGGCCGGCCCGCCACTGG + Intergenic
1154270289 18:12912433-12912455 CGTGCAGGACGGCACAGCGCAGG - Intronic
1154332681 18:13442600-13442622 CCTGCTGGCCGGCCGGCTGCGGG + Intronic
1158436127 18:57436391-57436413 CCCGCTGGCCGCCACGCCGCTGG + Exonic
1160144043 18:76349516-76349538 CCTGCTGGCCTGCACGCCAAGGG + Intergenic
1160823620 19:1069280-1069302 ACTGCCGGCCTGCAGGCCGCTGG - Intronic
1160991699 19:1862905-1862927 CCTGCCGGCCGGCGCGGCGGCGG + Intronic
1161238074 19:3207763-3207785 CCTGCAGGGCCGCCCGCGGCGGG - Exonic
1161610427 19:5238967-5238989 CCTGGCGGCCCGCTCGCCGCAGG - Exonic
1162412492 19:10514900-10514922 CGCGCAGGCCGGCACCCGGCTGG + Exonic
1165128286 19:33616501-33616523 CCTGCAGGCCTGCCCACCTCAGG + Intergenic
1165772108 19:38385956-38385978 CCTGCAGGCCTGGAGGCCCCGGG + Exonic
925911655 2:8577722-8577744 CCTGGAGGTCGGCTCCCCGCAGG + Intergenic
933893222 2:86789651-86789673 GCCGCTGGCCGGCACGCCTCTGG + Exonic
935590527 2:104843177-104843199 CCTGCAGGCCGGCACTTGGAGGG - Intergenic
938072537 2:128316206-128316228 CCTGCAGCCCCGCACGCCTGTGG - Intronic
940774932 2:157875856-157875878 GCTGCAGGTCGGCGCGGCGCGGG + Intronic
942312401 2:174667729-174667751 CCTGGAGGCCGGCAAGCTGCAGG - Intronic
945194197 2:207223194-207223216 CCTGCTGGCCCACACGCTGCAGG - Intergenic
945401384 2:209387477-209387499 CCAGCCGGCCGGCAAGCCCCGGG + Intergenic
945720336 2:213410883-213410905 CCTGAAGTCCGGCACCCTGCGGG + Intronic
946329148 2:219000090-219000112 CCTGCAGGCCTGCCCGGCACTGG + Intergenic
948045537 2:234940786-234940808 CTTTCAGGCCAGCATGCCGCTGG + Intergenic
948770999 2:240251203-240251225 CCTGCAGGAGGCCACGCCTCTGG + Intergenic
948999083 2:241602071-241602093 CCTGCAAGCCGGGACTCCACAGG + Intronic
1168777835 20:462522-462544 CCTGCGCGCCTGCGCGCCGCTGG - Exonic
1171035003 20:21707111-21707133 CCTGCAAGCCTGCCCGCCCCAGG - Intronic
1171780190 20:29410767-29410789 CCAGCAGGCCGTCGCGCTGCGGG + Intergenic
1173221766 20:41137499-41137521 CCTGCAGGCGGACACGGGGCGGG - Exonic
1175394939 20:58651350-58651372 CCTGCAGGCCGGCAGCCTGCTGG + Exonic
1175986285 20:62765622-62765644 CCTGCAGGCCCACAGGCCGAAGG + Intergenic
1176294623 21:5064801-5064823 CCACCAGGCCCGCATGCCGCTGG + Intergenic
1176382760 21:6121306-6121328 CCTGCAGACCGGCGCGTCCCCGG + Exonic
1179630307 21:42673840-42673862 CCTGCAGGCCAGCGAGTCGCAGG - Intronic
1179740709 21:43416933-43416955 CCTGCAGACCGGCGCGTCCCCGG - Exonic
1179862427 21:44197325-44197347 CCACCAGGCCCGCATGCCGCTGG - Intergenic
1181169432 22:21000017-21000039 GCTGCAGGCCTGCAAGCGGCGGG - Exonic
1182472089 22:30554919-30554941 CGAGCAGGCAGGCAAGCCGCTGG + Exonic
1184497013 22:44847966-44847988 CCTGCAGGCCTGCGCACCGAGGG + Exonic
1184660721 22:45964409-45964431 CCTGCAGGCCAGCCCCCCCCAGG + Intronic
1184828953 22:46971920-46971942 CCTGCAGCCCGGCAGGGAGCCGG + Intronic
949895924 3:8767674-8767696 CCTGGTGGCCAGCGCGCCGCAGG - Exonic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
952152315 3:30606696-30606718 CCTGGAGGCCGGCGAGGCGCGGG - Exonic
954065707 3:48104272-48104294 CCTAGAGGCTGGCACGCCCCGGG - Intergenic
954293876 3:49663592-49663614 CCTGCAGGCTGGCTGGCAGCAGG - Exonic
957084909 3:75669742-75669764 CCAGCAGGCCGTCGCGCTGCGGG - Intergenic
959369395 3:105504570-105504592 CCAGCAGGCCGGCAGGCCGTGGG - Intronic
961515237 3:127428085-127428107 CTTGCAGGTCGGCATGCCGTGGG - Intergenic
961705838 3:128784488-128784510 ACTGCAGGCAGGCAGGGCGCTGG + Intronic
964848652 3:161070402-161070424 CCTGCAGGCCTGCAGGCCACGGG - Exonic
968084209 3:195867374-195867396 TCTGCTGGCCGGCCCGCCTCTGG + Exonic
968093209 3:195910372-195910394 CCTGCAGGCTGCCCCGCCGCTGG - Intronic
969214532 4:5711385-5711407 CTTGCAGGCCGCCCCGCCGCGGG - Exonic
970108308 4:12609730-12609752 CCGGCAGGCCTGCAAGCCCCGGG + Intergenic
973246594 4:48016754-48016776 CCCGCAGCCCCGCCCGCCGCGGG + Exonic
982647664 4:158044269-158044291 CCGGCAGGCCAGCAAGCCCCAGG + Intergenic
983238614 4:165207386-165207408 CCCGCAGGCCGGGACGCGGGCGG - Intronic
984095485 4:175428025-175428047 CCGGCAGGCCCGTACTCCGCGGG + Intergenic
985451331 4:190065454-190065476 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
985452321 4:190068747-190068769 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
985453306 4:190072044-190072066 CCGGCAGGCCGTCGCGCTGCGGG - Exonic
985454296 4:190075337-190075359 CCGGCAGGCCGTCGCGCTGCGGG - Exonic
985455284 4:190078630-190078652 CCGGCAGGCCGTCGCGCTGCGGG - Exonic
985456272 4:190081930-190081952 CCGGCAGGCCGTCGCGCTGCGGG - Exonic
985457256 4:190085224-190085246 CCGGCAGGCCGTCGCGCTGCGGG - Intergenic
985458243 4:190088517-190088539 CCGGCAGGCCGTCGCGCTGCGGG - Exonic
985459232 4:190091817-190091839 CCGGCAGGCCGTCGCGCTGCGGG - Exonic
985463484 4:190174586-190174608 CCGGCAGGCCGTCGCGCTGCGGG - Exonic
990332349 5:54740349-54740371 CCTGGAGGCCAGCACGCTGGAGG - Intergenic
994072835 5:95620872-95620894 CCTGCAGCCAGGCGCGCCCCCGG + Exonic
995867474 5:116707020-116707042 CCTGAAGTCCGGCACCCTGCAGG + Intergenic
1002912075 6:1498138-1498160 GCTGCAGGCCTGCAGGCCTCAGG - Intergenic
1005536372 6:26760048-26760070 CCTGGAGGCCAGCACTCCACAGG + Intergenic
1005990523 6:30899167-30899189 CCTGCGGGCAGGCAGGCGGCCGG - Exonic
1008230799 6:48983540-48983562 CCTGCAGCCCGCCATGCCTCAGG - Intergenic
1017820966 6:158048847-158048869 CCTGCAGGCTTGCAAGCCGACGG - Intronic
1019310814 7:359784-359806 CCTGCAGGCAGCCACGGCCCTGG - Intergenic
1019635700 7:2074558-2074580 TCTGCAGGCTGGCAGGCTGCTGG + Intronic
1023881835 7:44325248-44325270 ACTGCGGGCCCGCGCGCCGCCGG - Intronic
1031401668 7:121330659-121330681 CGTGCCGGCCAGAACGCCGCGGG - Intronic
1034131489 7:148722507-148722529 CCTGCAGGCCTCCAGGCTGCAGG + Intronic
1034347646 7:150397195-150397217 CCTGCAGCCGGGGCCGCCGCGGG + Exonic
1035600362 8:893675-893697 CCTGCAGGCAGGAGGGCCGCTGG - Intergenic
1036223974 8:6942984-6943006 CCTGCAGGCCGGGAGCCCACTGG - Intergenic
1037607859 8:20452689-20452711 CCTCCAGGCCTGCAGGCGGCTGG - Intergenic
1039591948 8:38757069-38757091 CCCGCAGCCCCGCACGCCCCAGG + Intronic
1047257471 8:123226302-123226324 CCTGCGGTCCCGCACGCTGCAGG + Exonic
1048833319 8:138496828-138496850 CCTCCAGGCAGCCTCGCCGCGGG - Intergenic
1049080474 8:140439121-140439143 CCTGCAGGCAGGGATGCTGCAGG - Exonic
1058699581 9:107589406-107589428 CCTGCATGCCAGCAGGCAGCAGG - Intergenic
1062260964 9:135663248-135663270 CCTGCAGGGCTGGAAGCCGCAGG + Intergenic
1062502646 9:136857968-136857990 CCTGCTGGCAGGCACCCTGCGGG + Exonic
1062537719 9:137028202-137028224 CCCGCAGCCCGCCGCGCCGCTGG + Intronic
1062582348 9:137234161-137234183 CCTGCTGGCCGGCTCCCTGCTGG + Exonic
1186274734 X:7927199-7927221 CCTGCCGGCCTCCAAGCCGCGGG - Intronic
1199772560 X:150983926-150983948 CCTGCGGGCCCGCGCGGCGCCGG - Intronic
1199881205 X:151975063-151975085 CCTGCCCGCTGGCACGCCGCGGG + Intergenic
1201179761 Y:11333143-11333165 CCGGCAGGCTGTCACGCTGCGGG - Intergenic