ID: 1076874239

View in Genome Browser
Species Human (GRCh38)
Location 10:133208104-133208126
Sequence CTCTCTGAGCAGAGGCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076874231_1076874239 -4 Left 1076874231 10:133208085-133208107 CCTTGGAGCCCCAAGGGTCCTCT No data
Right 1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG No data
1076874226_1076874239 10 Left 1076874226 10:133208071-133208093 CCCTTATGACACCACCTTGGAGC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG No data
1076874222_1076874239 30 Left 1076874222 10:133208051-133208073 CCCCATGTTGGCTTATGGGACCC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG No data
1076874224_1076874239 28 Left 1076874224 10:133208053-133208075 CCATGTTGGCTTATGGGACCCTT 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG No data
1076874223_1076874239 29 Left 1076874223 10:133208052-133208074 CCCATGTTGGCTTATGGGACCCT 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG No data
1076874227_1076874239 9 Left 1076874227 10:133208072-133208094 CCTTATGACACCACCTTGGAGCC 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG No data
1076874230_1076874239 -1 Left 1076874230 10:133208082-133208104 CCACCTTGGAGCCCCAAGGGTCC 0: 1
1: 0
2: 1
3: 12
4: 191
Right 1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076874239 Original CRISPR CTCTCTGAGCAGAGGCCATG GGG Intronic
No off target data available for this crispr