ID: 1076878882

View in Genome Browser
Species Human (GRCh38)
Location 10:133230483-133230505
Sequence CCGGGAGACGGAGCTGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 344}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076878870_1076878882 18 Left 1076878870 10:133230442-133230464 CCGGTGTCCCCGGGCTCGGCGCA 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1076878882 10:133230483-133230505 CCGGGAGACGGAGCTGCTGCTGG 0: 1
1: 0
2: 1
3: 47
4: 344
1076878872_1076878882 10 Left 1076878872 10:133230450-133230472 CCCGGGCTCGGCGCAGCGCACGC 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1076878882 10:133230483-133230505 CCGGGAGACGGAGCTGCTGCTGG 0: 1
1: 0
2: 1
3: 47
4: 344
1076878873_1076878882 9 Left 1076878873 10:133230451-133230473 CCGGGCTCGGCGCAGCGCACGCC 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1076878882 10:133230483-133230505 CCGGGAGACGGAGCTGCTGCTGG 0: 1
1: 0
2: 1
3: 47
4: 344
1076878871_1076878882 11 Left 1076878871 10:133230449-133230471 CCCCGGGCTCGGCGCAGCGCACG 0: 1
1: 0
2: 0
3: 12
4: 88
Right 1076878882 10:133230483-133230505 CCGGGAGACGGAGCTGCTGCTGG 0: 1
1: 0
2: 1
3: 47
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076878882 Original CRISPR CCGGGAGACGGAGCTGCTGC TGG Exonic