ID: 1076879427

View in Genome Browser
Species Human (GRCh38)
Location 10:133232522-133232544
Sequence ACTAGCGGGAACTATTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076879427_1076879432 -4 Left 1076879427 10:133232522-133232544 CCAGAAGAATAGTTCCCGCTAGT No data
Right 1076879432 10:133232541-133232563 TAGTGCTAAAGGCTGCTCCTGGG No data
1076879427_1076879436 17 Left 1076879427 10:133232522-133232544 CCAGAAGAATAGTTCCCGCTAGT No data
Right 1076879436 10:133232562-133232584 GGGAAATGAACGGCTTGCCCAGG No data
1076879427_1076879440 27 Left 1076879427 10:133232522-133232544 CCAGAAGAATAGTTCCCGCTAGT No data
Right 1076879440 10:133232572-133232594 CGGCTTGCCCAGGTCTGAGGGGG No data
1076879427_1076879433 -3 Left 1076879427 10:133232522-133232544 CCAGAAGAATAGTTCCCGCTAGT No data
Right 1076879433 10:133232542-133232564 AGTGCTAAAGGCTGCTCCTGGGG No data
1076879427_1076879431 -5 Left 1076879427 10:133232522-133232544 CCAGAAGAATAGTTCCCGCTAGT No data
Right 1076879431 10:133232540-133232562 CTAGTGCTAAAGGCTGCTCCTGG No data
1076879427_1076879437 24 Left 1076879427 10:133232522-133232544 CCAGAAGAATAGTTCCCGCTAGT No data
Right 1076879437 10:133232569-133232591 GAACGGCTTGCCCAGGTCTGAGG No data
1076879427_1076879438 25 Left 1076879427 10:133232522-133232544 CCAGAAGAATAGTTCCCGCTAGT No data
Right 1076879438 10:133232570-133232592 AACGGCTTGCCCAGGTCTGAGGG No data
1076879427_1076879441 30 Left 1076879427 10:133232522-133232544 CCAGAAGAATAGTTCCCGCTAGT No data
Right 1076879441 10:133232575-133232597 CTTGCCCAGGTCTGAGGGGGAGG No data
1076879427_1076879439 26 Left 1076879427 10:133232522-133232544 CCAGAAGAATAGTTCCCGCTAGT No data
Right 1076879439 10:133232571-133232593 ACGGCTTGCCCAGGTCTGAGGGG No data
1076879427_1076879434 7 Left 1076879427 10:133232522-133232544 CCAGAAGAATAGTTCCCGCTAGT No data
Right 1076879434 10:133232552-133232574 GCTGCTCCTGGGGAAATGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076879427 Original CRISPR ACTAGCGGGAACTATTCTTC TGG (reversed) Intergenic
No off target data available for this crispr