ID: 1076879429

View in Genome Browser
Species Human (GRCh38)
Location 10:133232536-133232558
Sequence GAGCAGCCTTTAGCACTAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076879429_1076879438 11 Left 1076879429 10:133232536-133232558 CCCGCTAGTGCTAAAGGCTGCTC No data
Right 1076879438 10:133232570-133232592 AACGGCTTGCCCAGGTCTGAGGG No data
1076879429_1076879441 16 Left 1076879429 10:133232536-133232558 CCCGCTAGTGCTAAAGGCTGCTC No data
Right 1076879441 10:133232575-133232597 CTTGCCCAGGTCTGAGGGGGAGG No data
1076879429_1076879434 -7 Left 1076879429 10:133232536-133232558 CCCGCTAGTGCTAAAGGCTGCTC No data
Right 1076879434 10:133232552-133232574 GCTGCTCCTGGGGAAATGAACGG No data
1076879429_1076879437 10 Left 1076879429 10:133232536-133232558 CCCGCTAGTGCTAAAGGCTGCTC No data
Right 1076879437 10:133232569-133232591 GAACGGCTTGCCCAGGTCTGAGG No data
1076879429_1076879440 13 Left 1076879429 10:133232536-133232558 CCCGCTAGTGCTAAAGGCTGCTC No data
Right 1076879440 10:133232572-133232594 CGGCTTGCCCAGGTCTGAGGGGG No data
1076879429_1076879436 3 Left 1076879429 10:133232536-133232558 CCCGCTAGTGCTAAAGGCTGCTC No data
Right 1076879436 10:133232562-133232584 GGGAAATGAACGGCTTGCCCAGG No data
1076879429_1076879439 12 Left 1076879429 10:133232536-133232558 CCCGCTAGTGCTAAAGGCTGCTC No data
Right 1076879439 10:133232571-133232593 ACGGCTTGCCCAGGTCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076879429 Original CRISPR GAGCAGCCTTTAGCACTAGC GGG (reversed) Intergenic
No off target data available for this crispr