ID: 1076879438

View in Genome Browser
Species Human (GRCh38)
Location 10:133232570-133232592
Sequence AACGGCTTGCCCAGGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076879429_1076879438 11 Left 1076879429 10:133232536-133232558 CCCGCTAGTGCTAAAGGCTGCTC No data
Right 1076879438 10:133232570-133232592 AACGGCTTGCCCAGGTCTGAGGG No data
1076879430_1076879438 10 Left 1076879430 10:133232537-133232559 CCGCTAGTGCTAAAGGCTGCTCC No data
Right 1076879438 10:133232570-133232592 AACGGCTTGCCCAGGTCTGAGGG No data
1076879427_1076879438 25 Left 1076879427 10:133232522-133232544 CCAGAAGAATAGTTCCCGCTAGT No data
Right 1076879438 10:133232570-133232592 AACGGCTTGCCCAGGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076879438 Original CRISPR AACGGCTTGCCCAGGTCTGA GGG Intergenic
No off target data available for this crispr