ID: 1076890122

View in Genome Browser
Species Human (GRCh38)
Location 10:133279235-133279257
Sequence TTGGAGCAGCAGCAGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1000
Summary {0: 1, 1: 1, 2: 10, 3: 117, 4: 871}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076890107_1076890122 23 Left 1076890107 10:133279189-133279211 CCAGGGTGCCTGAGGGCCCTGTC 0: 1
1: 0
2: 1
3: 31
4: 286
Right 1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG 0: 1
1: 1
2: 10
3: 117
4: 871
1076890106_1076890122 24 Left 1076890106 10:133279188-133279210 CCCAGGGTGCCTGAGGGCCCTGT 0: 1
1: 0
2: 0
3: 34
4: 283
Right 1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG 0: 1
1: 1
2: 10
3: 117
4: 871
1076890109_1076890122 15 Left 1076890109 10:133279197-133279219 CCTGAGGGCCCTGTCTGTGGCCT 0: 1
1: 0
2: 2
3: 27
4: 368
Right 1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG 0: 1
1: 1
2: 10
3: 117
4: 871
1076890114_1076890122 -5 Left 1076890114 10:133279217-133279239 CCTCCTGCCCTGGACCAGTTGGA 0: 1
1: 0
2: 2
3: 16
4: 184
Right 1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG 0: 1
1: 1
2: 10
3: 117
4: 871
1076890115_1076890122 -8 Left 1076890115 10:133279220-133279242 CCTGCCCTGGACCAGTTGGAGCA 0: 1
1: 0
2: 3
3: 16
4: 165
Right 1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG 0: 1
1: 1
2: 10
3: 117
4: 871
1076890111_1076890122 6 Left 1076890111 10:133279206-133279228 CCTGTCTGTGGCCTCCTGCCCTG 0: 1
1: 0
2: 6
3: 56
4: 530
Right 1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG 0: 1
1: 1
2: 10
3: 117
4: 871
1076890110_1076890122 7 Left 1076890110 10:133279205-133279227 CCCTGTCTGTGGCCTCCTGCCCT 0: 1
1: 0
2: 10
3: 97
4: 596
Right 1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG 0: 1
1: 1
2: 10
3: 117
4: 871

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076890122 Original CRISPR TTGGAGCAGCAGCAGGAGGA GGG Exonic
900038797 1:439841-439863 TCGGAGGAGCAGGAGGAGTAAGG + Intergenic
900121498 1:1050334-1050356 GTGGGGCAGGAGCAGGGGGAAGG + Intronic
900317784 1:2068100-2068122 TTGGGGCAGCAGCGAGAGCAAGG + Intronic
900467026 1:2830868-2830890 ATGAAGCAGCAGCAGGCGGCGGG - Intergenic
900595865 1:3479892-3479914 CTGGTTCTGCAGCAGGAGGATGG + Exonic
901213635 1:7540899-7540921 TTGCTGCACCAACAGGAGGAGGG + Intronic
901354643 1:8634155-8634177 TAGTAGCAGCAGCGTGAGGATGG - Intronic
901604731 1:10450237-10450259 GAGCAGCAGCAGCAGGAGGCCGG - Exonic
902546025 1:17190824-17190846 GTGTAGCAGCAGCGTGAGGAAGG - Intergenic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902783922 1:18721025-18721047 CGGGAGCAGCAGCAGCAGGCAGG + Intronic
902844722 1:19100888-19100910 TGAGACCAGCAGGAGGAGGAAGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903190617 1:21653672-21653694 TAGTAGCAGCAGCAGCAGCAGGG + Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903575795 1:24339019-24339041 ATGAAGCAGCAGCAGCAGTATGG - Intronic
903788183 1:25875197-25875219 TGGGAGGAGCAGAAGGAGCACGG - Intergenic
903861083 1:26364874-26364896 TTGGGGCAGCATGAGGAGGTGGG + Exonic
903864758 1:26389912-26389934 TAGGAGCAGAATGAGGAGGAAGG + Intergenic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904120322 1:28193924-28193946 AATGAGCAGCAGCAGGATGAAGG + Intronic
904187099 1:28714087-28714109 TTGGAGGAGCAGAAGAAGCAAGG + Exonic
904295184 1:29515711-29515733 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
904933213 1:34107056-34107078 CTGGATCAGCAGCAAGAGAAAGG + Intronic
906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG + Intronic
906052714 1:42888035-42888057 CACGAGCAGCAGCAGCAGGAAGG + Intergenic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906192036 1:43904993-43905015 TGGGAAGAGGAGCAGGAGGAGGG - Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906615153 1:47228847-47228869 CTGGAGCTCCCGCAGGAGGAAGG - Intronic
907362706 1:53932667-53932689 TTGGAGCTGAGGCATGAGGATGG - Intronic
907475214 1:54700968-54700990 TTTGAGGAGCAGCAAGAGGTTGG + Intronic
907484995 1:54771452-54771474 TTAGAGGAGCAGCAGGTGCAAGG - Intergenic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907938115 1:59060957-59060979 TGGGAGCAGCAGTGGGAGCATGG - Intergenic
908141225 1:61187370-61187392 TTGGAGAAGCAGCTGAGGGATGG - Intronic
908532680 1:65048850-65048872 TGGGAGCAGCTGTACGAGGAAGG + Intergenic
908662207 1:66448985-66449007 TTGGTGCACAAGCAGGAGGAGGG + Intergenic
909935239 1:81543574-81543596 TTGGGGTAGCAGCAGCAGAAGGG - Intronic
910238733 1:85063317-85063339 GTGGACCAGGAGCAGCAGGAGGG + Intronic
910746472 1:90580319-90580341 CTGCAGCAGCTGCAGGGGGAGGG - Intergenic
912167472 1:107057502-107057524 TTGGAGCAGGAGCTGGAGGCCGG + Exonic
912498481 1:110106568-110106590 AAGGAGCTGGAGCAGGAGGAAGG - Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913196095 1:116457476-116457498 ATGAAGCAGCAGCAGGTGGCGGG - Intergenic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
914681162 1:149939183-149939205 TGGGAGGGGCAGCCGGAGGAGGG + Exonic
914918314 1:151831553-151831575 CTGGAGGAGAAACAGGAGGAGGG - Intronic
914923727 1:151865375-151865397 AGGGAGTTGCAGCAGGAGGAAGG - Intergenic
915200216 1:154221301-154221323 TTGGAGCAGCCGTAGGAAGGGGG + Intronic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915528901 1:156492175-156492197 TTGGGGCGGCAGCAGCAGGAGGG + Intronic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
916143781 1:161722639-161722661 CTGCAGCAGCTGCAGAAGGATGG - Exonic
916308514 1:163367549-163367571 CTGGAACAGCAGCAGGAACATGG - Intergenic
916443098 1:164846716-164846738 TTGGGGCAGGGGCAGGAGGGAGG + Exonic
916556527 1:165898647-165898669 TTTGAGCAGCAGCAAGACGCTGG + Intronic
916880593 1:169016499-169016521 TTGCAGCAGGAGTAGGAGAAAGG - Intergenic
917288722 1:173449152-173449174 TGAGAGCAGGAGCAGGAGTAGGG - Intergenic
917815543 1:178706202-178706224 GTGGAGGAGCAGTAGGAGAATGG + Intergenic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
918725575 1:187917612-187917634 TAGGAGGAGGAGCAGAAGGATGG - Intergenic
918860984 1:189826064-189826086 TTGGTGAAGCAGCAGCACGATGG - Intergenic
919797715 1:201331390-201331412 TCAGACCAGCAGCAGCAGGAGGG + Exonic
920034494 1:203056988-203057010 TTGGGGCATCAGAAGCAGGAAGG + Intronic
920084927 1:203408523-203408545 TGGGAGTAGTAGTAGGAGGAGGG + Intergenic
920654637 1:207866678-207866700 TTGGAGTAGATGCAGGGGGAAGG - Intergenic
920686214 1:208110795-208110817 TTGGGGCAGCTCCAGGAGAAGGG - Intronic
920949176 1:210556563-210556585 TTTGTGTATCAGCAGGAGGAAGG - Intronic
921060251 1:211578961-211578983 CCGGAGCAGGAGCAGGAGGGCGG + Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922059792 1:222077400-222077422 ATGTGGCAGCAGCAGGAGGTTGG - Intergenic
922276667 1:224085624-224085646 TTGGACCATCAGCAGGAAGCTGG - Intergenic
922741646 1:228017375-228017397 GTGGAGAGGCCGCAGGAGGAGGG + Intronic
922745013 1:228038613-228038635 TGGGGGCAGCACCAGGAGGGAGG + Intronic
922977920 1:229800659-229800681 TTGGAGGGGCAGCAGGAACAGGG + Intergenic
923117702 1:230958888-230958910 TTGGGGCTGAGGCAGGAGGATGG + Intronic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
924226331 1:241924857-241924879 TTGGATTTTCAGCAGGAGGAGGG + Intergenic
924645324 1:245872345-245872367 TGGGTGAAGCAGCAGGAGGCGGG - Intronic
924682184 1:246248526-246248548 TTAGAGCATGAGCAAGAGGAAGG - Intronic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
924708103 1:246514140-246514162 TTGGGGCAGCCCCAGGAGGAGGG + Intergenic
924735283 1:246750095-246750117 TTCGAACAGCAGAAAGAGGATGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063108845 10:3017619-3017641 TGGGAGCAGAGGCAGGAGGAAGG + Intergenic
1063372262 10:5529515-5529537 TGGGGGCTGGAGCAGGAGGAAGG + Intergenic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1063958647 10:11287971-11287993 ATGTGGCAGCAGCTGGAGGAAGG - Intronic
1064122817 10:12634409-12634431 TGGGGGCAGAGGCAGGAGGATGG - Intronic
1065223978 10:23524218-23524240 TAGGAGCAGGAGCAGGAGCAGGG + Intergenic
1065241346 10:23708346-23708368 ATTGAACAGCAGCAGAAGGAGGG + Intronic
1065403408 10:25332926-25332948 TTAGAGCAGCAGGAGAAGTATGG + Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067269375 10:44775922-44775944 TTAGAGCATCAGTCGGAGGAAGG + Intergenic
1067525655 10:47036804-47036826 TGGGTGCAGCAGCAGAAAGATGG + Intergenic
1067537701 10:47126707-47126729 TTGTAGCAGTGGCAGAAGGAAGG - Intergenic
1067774945 10:49156682-49156704 ATGGGGCAGCAACAGCAGGAAGG + Intronic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1069061481 10:63899344-63899366 TTGGGGTAGGAGGAGGAGGAGGG - Intergenic
1069748102 10:70728783-70728805 TTGGAGCAGCAGCAGCACCTGGG - Intronic
1069979562 10:72242800-72242822 TAGGAGGGGCAGCAGGAAGAGGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071251026 10:83819940-83819962 TTGTAGCAGCAGTTGGATGATGG - Intergenic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072082732 10:92048005-92048027 TTGGAAAAGCAGCAGCAGAAAGG + Intronic
1072092093 10:92138422-92138444 GAGGAGCAGCAGGAGGCGGAAGG + Intronic
1072759430 10:98043698-98043720 TGGGAGTAGAAGCAGGAGGAAGG + Intergenic
1072932648 10:99680264-99680286 TTGCAGTAGCAGCAAGAAGAGGG - Intronic
1074210001 10:111322524-111322546 TGGCAGCAGCAGTAGGAGGATGG + Intergenic
1074426591 10:113356897-113356919 TTGGAGCAACAGCAGGCATAAGG - Intergenic
1074447391 10:113531665-113531687 GTGAAACTGCAGCAGGAGGATGG - Intergenic
1074591244 10:114815864-114815886 TTAGGGCAGTAGTAGGAGGAAGG - Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075213147 10:120508766-120508788 TTTGAGTAGCAGGAGGAGGTTGG - Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075812202 10:125232451-125232473 TGGGACCACCAGCAGGAGTAGGG + Intergenic
1076209994 10:128632613-128632635 TTAGAGCAGCATCAGGCAGATGG - Intergenic
1076252722 10:128996606-128996628 TTGCAGCAGACACAGGAGGATGG - Intergenic
1076457127 10:130608267-130608289 TGGGAGAAGCACCAGGGGGAGGG - Intergenic
1076485910 10:130816844-130816866 TGGGAACTGCAGCAGGTGGAGGG - Intergenic
1076605559 10:131687094-131687116 ATGGAGCAGCAGCAGGGGCCTGG - Intergenic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1076772875 10:132676681-132676703 TTGGAGCAGAGTCAGGAGGAGGG - Intronic
1076872788 10:133201851-133201873 CTGGGGCGGCAGCAGGCGGACGG + Exonic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076931504 10:133534690-133534712 TAGCAGCAGCTTCAGGAGGAGGG - Intronic
1076965005 11:75752-75774 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077123483 11:921900-921922 TTGGCCCAGCAGCAGCCGGACGG + Intergenic
1077198417 11:1293139-1293161 CTGGAGCACCAGCAGCACGAGGG + Intronic
1077222094 11:1422310-1422332 GTGGAGGAGCGGCTGGAGGAGGG - Intronic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077387099 11:2275197-2275219 TTTGAGGAGCTGCAGGAGGATGG - Intergenic
1077483272 11:2826528-2826550 TCGGGGAAGCAGCAGCAGGAGGG - Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1077845054 11:6014362-6014384 TGAGAGCAGCACCCGGAGGATGG - Intergenic
1078060685 11:8040703-8040725 AAGGAGCAGTAGGAGGAGGAGGG + Intronic
1078063250 11:8061698-8061720 TAGGGGCAGCGGCAGGAGGCAGG - Intronic
1078142997 11:8705141-8705163 TTTGAGCTGCAGGAGCAGGAGGG - Intronic
1078525504 11:12097964-12097986 TTGGGGCCGAGGCAGGAGGATGG - Intronic
1078759155 11:14237857-14237879 TAAGAGCAGCAGAAGTAGGAGGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080414651 11:32057982-32058004 TGGGAACAGCAGCAGGAGAGAGG + Intronic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081752611 11:45522695-45522717 TAGGAGTAGGAGCAGGTGGAGGG + Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1082771053 11:57207596-57207618 GTAGAGAAGTAGCAGGAGGAAGG - Intergenic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1083616416 11:64028687-64028709 TGGGAGGAGCTGCGGGAGGAGGG - Intronic
1083680203 11:64348287-64348309 TTGGAGCAGGAGAAGGTGGCTGG + Intronic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1085666312 11:78417940-78417962 GGGGAGCAGCTGCAGCAGGAAGG + Intronic
1086084479 11:82940691-82940713 TGGGAGCAGGAGCAAGAGTAGGG + Intronic
1086132759 11:83418889-83418911 TTGGGGCAGCAGCAGAATTATGG + Intergenic
1086188814 11:84053261-84053283 TTGGAGGGGAAGCAGGAGGAAGG + Intronic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088723145 11:112612148-112612170 TTGGGGCTGCAGCAGGAAAACGG + Intergenic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089589234 11:119529936-119529958 TAGAAACAGCAGCTGGAGGAAGG - Intergenic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1090332338 11:125941853-125941875 TTGGAGCAGCAGCATGTGAAAGG - Intergenic
1090402844 11:126460097-126460119 GAGGAGCGGGAGCAGGAGGAGGG + Intronic
1090611092 11:128471414-128471436 TGGGGGCGGCAGCAGGAGAAAGG + Intronic
1090673807 11:128970609-128970631 TTGGAGCAGCACCAAGTGTATGG - Exonic
1090681768 11:129067089-129067111 TTTGACCAGCAGTAGGAAGAGGG - Intronic
1090872668 11:130762121-130762143 TTGGAGCAGTTGGAGAAGGAGGG - Intergenic
1090977243 11:131688518-131688540 TGGGAGCAGCAGGCGGAGGGAGG - Intronic
1091028396 11:132161745-132161767 ATGGCGCAGCTGCGGGAGGAGGG - Intronic
1091180433 11:133599575-133599597 ATGGAGCAAAAGCAGGAGAATGG - Intergenic
1091305886 11:134535833-134535855 TAAGAGCAGCAGGAGGAGCACGG - Intergenic
1091545624 12:1499703-1499725 TGGGAGCAGCAGGAGGAGTTGGG - Intergenic
1091635553 12:2194102-2194124 GAGGAGCAGGAGGAGGAGGACGG - Intronic
1091843026 12:3633928-3633950 TTCCAGCATCCGCAGGAGGAAGG + Intronic
1092087017 12:5770917-5770939 TTGGAGCAGATGGAGGAGGTAGG - Intronic
1092153091 12:6264566-6264588 TGGCAGCAGCAGCAGAAGCAGGG + Intergenic
1092503795 12:9074272-9074294 GTGGAGCACCAGCAGAATGAAGG - Intronic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1094535683 12:31320816-31320838 TTCAAGCAGGAGCAGGGGGAAGG + Intronic
1095903914 12:47357759-47357781 CTGGAGCAGTAGCACGATGAAGG + Intergenic
1096005643 12:48168850-48168872 CTGGAGCAGCCGGAGGAGCACGG + Intronic
1096072352 12:48782415-48782437 TGGGAGGAGGAGCAGGAGGTGGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096193382 12:49634061-49634083 TTCCTGCAGCAGCTGGAGGAGGG + Exonic
1096426353 12:51507087-51507109 TTGGAGCAGCCTCAGGAGTGGGG - Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096777401 12:53972750-53972772 TGTGAGCAGCACCAGGAGGGTGG - Intergenic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1096846536 12:54410228-54410250 GTGGAGCAGGGGCAGGAGGATGG + Intronic
1097098755 12:56571252-56571274 ATGGAGGAAGAGCAGGAGGAGGG - Intronic
1097594436 12:61610866-61610888 TTCGAGGGGCAGCAGGAAGAGGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097775780 12:63643636-63643658 TTGGTTCAGCAGCAGAAGGATGG + Intronic
1097827005 12:64184492-64184514 GGGCAGCAGTAGCAGGAGGAAGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098414970 12:70223072-70223094 AAGAAGCAGAAGCAGGAGGAAGG - Intergenic
1098945604 12:76586054-76586076 TTGCAGCTGCATCTGGAGGAGGG + Intergenic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1101211464 12:102539117-102539139 TTTCAGCAGCAGCAGCAGCAGGG + Intergenic
1101323493 12:103694371-103694393 TTGGAGCTGAAGGGGGAGGAGGG - Intronic
1101475391 12:105041932-105041954 TTGGAGAAGTAGCTGGAGTAGGG - Intronic
1101654417 12:106707486-106707508 GGGGAGGAGCAGCAGAAGGAGGG + Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101944997 12:109129928-109129950 TTGGTGCAGCAGGAAGGGGAAGG + Intronic
1103329496 12:120144344-120144366 CTGGGGCAGCAGCAGGGCGATGG + Exonic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1103398906 12:120629065-120629087 TGGGAGCGGCAGCAGGAGATGGG - Intergenic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103830531 12:123775626-123775648 TTGGCCCAGTAGCAGGAGGATGG + Intronic
1103900034 12:124298688-124298710 GTGTGGCAGCAGCAGGTGGATGG + Intronic
1103938683 12:124490177-124490199 TTGGAGCTGAACCTGGAGGAAGG - Intronic
1104005590 12:124890044-124890066 ATGGTGGAGCAGCAGGAGGTGGG - Intergenic
1104107381 12:125675858-125675880 TTTGAGAAGGTGCAGGAGGATGG + Intergenic
1104250738 12:127091057-127091079 ATGGAGCAGCACCACTAGGATGG + Intergenic
1104835461 12:131787120-131787142 TTGGAGCAGGAGATGGAGGGAGG + Intronic
1104900843 12:132188857-132188879 GAGGAGCAGGAGCAGGAGGGAGG + Intergenic
1104947420 12:132422354-132422376 TGCGAGCAGCAGCAGGATGCTGG + Intergenic
1104992161 12:132631841-132631863 TGGGACCAGGTGCAGGAGGAGGG - Intronic
1105874247 13:24539564-24539586 CTGGGGCTGCTGCAGGAGGAGGG - Intergenic
1106021420 13:25919545-25919567 TTAGGGCAGGAGCTGGAGGAGGG - Intronic
1106466350 13:30017727-30017749 TTGGAGGGGCTGCAGGGGGAGGG - Intergenic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1106559730 13:30837912-30837934 TTGGAGATGGAGCAGTAGGAGGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106621377 13:31374196-31374218 TGGGAAAAGAAGCAGGAGGAGGG - Intergenic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1107722839 13:43267135-43267157 CTGGAGCTGCAGCTCGAGGAAGG - Intronic
1108287800 13:48925905-48925927 TTGGGGCATGAGCAGCAGGAAGG + Intergenic
1108373427 13:49792567-49792589 TTGGAGCGGGAGGGGGAGGAGGG + Exonic
1108437938 13:50419702-50419724 TTACAGCAGGAGGAGGAGGAGGG + Intronic
1108639705 13:52371706-52371728 TAACAGCAGCAGCAGCAGGATGG + Intergenic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1108809287 13:54201503-54201525 AAGGAACAGCAGCAAGAGGATGG - Intergenic
1109134135 13:58625711-58625733 TGGCAGCAGCAGCAGCAGGCAGG - Intergenic
1111488824 13:88942852-88942874 TTTGAGCAGCTGTAGTAGGAGGG + Intergenic
1111798434 13:92953587-92953609 ATGGTGCAGCAGCAGACGGAAGG + Intergenic
1112352974 13:98651943-98651965 TTGGAGCAGCTGGAAGAAGAAGG - Intergenic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1114350637 14:21846760-21846782 TGGGACGAGCAGCAGGAGCATGG - Intergenic
1114354706 14:21894559-21894581 TGGGACGAGCAGCAGGAGCATGG - Intergenic
1114361507 14:21978677-21978699 TGGGACGAGCAGCAGGAGCATGG - Intergenic
1114713446 14:24801657-24801679 TGGAAGCAGCAGGAGGAGAAGGG + Intergenic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1115753259 14:36510729-36510751 TTAGAGCAGCAGCATTAGGAGGG + Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1117081439 14:52156087-52156109 TCGGAGCAGCAGCAGAAGCCGGG + Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118229698 14:63936616-63936638 TTGGAGCAGAAGCAGCAGGTGGG + Intronic
1118622886 14:67630409-67630431 TTGTAGCCTCAGCAGCAGGATGG + Intronic
1118882087 14:69837717-69837739 TTTGAGCAGGAGCAGAAGAAAGG - Intergenic
1118973736 14:70659524-70659546 AAGCAGCCGCAGCAGGAGGAGGG + Intronic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119217608 14:72881106-72881128 TTGGAGCTGCAGGAGGATGATGG - Intronic
1119431360 14:74570095-74570117 TTGGAGGAGGGGCTGGAGGAAGG + Intronic
1119485181 14:74982167-74982189 TGGGAGAAGCAGCAGGACGTGGG + Intergenic
1120765139 14:88322137-88322159 TCAGAGTAGAAGCAGGAGGAGGG - Intronic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1121638307 14:95468478-95468500 TGGGAGCAGCCTCAGGAGCAAGG - Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1122037335 14:98958293-98958315 TGGGAGCAGCTGCAGGAAAAGGG - Intergenic
1122505608 14:102229939-102229961 TTGGAGCTAGAGCAGGAGGCAGG - Intronic
1122688204 14:103519901-103519923 ATGGAGCAGCGGCTGGAGCAGGG - Exonic
1122785857 14:104162956-104162978 TTGGAGCAGCACCAGGCAGCAGG + Intronic
1123022665 14:105408958-105408980 GAGGAGGAGGAGCAGGAGGAGGG - Intronic
1123217146 14:106821377-106821399 TTGGAGCAGCTACAGGAGTCAGG - Intergenic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1124955022 15:34354640-34354662 GGGCAGCAGCAGGAGGAGGAAGG + Exonic
1125311103 15:38378949-38378971 GAGTAGCAGCAACAGGAGGAAGG - Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1128205093 15:65844041-65844063 TGGGAGCTGAGGCAGGAGGATGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128719751 15:69939760-69939782 TTGGGGCAGCAGCAGCAGAGAGG + Intergenic
1128726815 15:69994049-69994071 TAGGAACAACAGCAGGAGGTGGG + Intergenic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1128987295 15:72230826-72230848 TTGGGGCAGGAGGAAGAGGATGG + Intronic
1129148551 15:73671786-73671808 TTGGAGCCACAGCACGGGGAGGG - Intergenic
1129261093 15:74367721-74367743 TTGAGCCTGCAGCAGGAGGAAGG - Exonic
1129473370 15:75767195-75767217 TGGGAGCAGAATCAAGAGGATGG - Intergenic
1129698479 15:77754178-77754200 AGGGAGCAGGAGCAAGAGGATGG + Intronic
1129756492 15:78102140-78102162 GGGGGGCAGAAGCAGGAGGATGG + Intronic
1129809183 15:78493205-78493227 ATAGAGCACAAGCAGGAGGAAGG + Intronic
1131069486 15:89456817-89456839 TTGGAGCAGCAAAGGAAGGAGGG + Intergenic
1131215410 15:90531028-90531050 TTGGAGGACCATCGGGAGGATGG + Intronic
1131269083 15:90935553-90935575 GTGGAGCAGCTGCGGAAGGAGGG + Exonic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132443117 15:101887764-101887786 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1132549152 16:547232-547254 GAGGAGCAGGAGGAGGAGGAGGG + Exonic
1132747327 16:1442488-1442510 TTGCTGCAGCAGGAGGAGCAGGG - Exonic
1132748363 16:1446241-1446263 TCGGGGCAGCAGCAGGGGCAAGG + Exonic
1133357722 16:5148644-5148666 TGGCAGCAGCAGCAGCTGGAGGG + Intergenic
1133404767 16:5514720-5514742 GAGGAGCAGGAGGAGGAGGAGGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1134053795 16:11156551-11156573 CTGAAACGGCAGCAGGAGGAAGG - Intronic
1135196583 16:20399732-20399754 TTCAAGCAGGAGCTGGAGGAGGG - Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135326248 16:21527514-21527536 TGGAAGCAGCAGCCAGAGGAAGG - Intergenic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135867897 16:26121548-26121570 TTGGATCAGTAGCAGGATGCAGG + Intronic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136294240 16:29292540-29292562 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136458488 16:30395600-30395622 TGGGAGGAGCAGCAGGTGCAGGG + Intronic
1136477807 16:30524416-30524438 GTGGAGAAGCCGCAGGAGAATGG - Exonic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1138504598 16:57471762-57471784 TGGAAGCAGCCGCAGGAGCAAGG + Exonic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1141178997 16:81739580-81739602 TAGGGGCAGCCGCAGGAGAAGGG - Intronic
1141334857 16:83145088-83145110 TTGGAGGAGCAGCATATGGATGG - Intronic
1141530509 16:84643395-84643417 TGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1141729465 16:85812096-85812118 TTGGTGCAGCAGGACGCGGAGGG + Intergenic
1142039295 16:87882241-87882263 TGGAAGCAGCAGCCAGAGGAAGG - Exonic
1142100144 16:88266586-88266608 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1142103412 16:88288077-88288099 TTGGAGCAGCAGGAGGAAAAAGG - Intergenic
1142338963 16:89508422-89508444 ACGGAGCAGCAGCAGCAGCACGG - Exonic
1142642480 17:1292447-1292469 CTCGAGCAGCACCAGAAGGAGGG - Intronic
1142701676 17:1666059-1666081 TGGGAGCTGAAGCAGGAGAATGG + Intronic
1143095815 17:4477767-4477789 TTGGAGCAGCACAGGGAGGTGGG - Intronic
1143149957 17:4801581-4801603 TGGTGGCAGCAGCAGGGGGAGGG + Intergenic
1143205056 17:5135546-5135568 TTGGAGCAGCCCCAGGAGGAGGG - Intronic
1143220168 17:5255026-5255048 TGGGTGCAGGAGCAGGAGCACGG - Intergenic
1143475914 17:7203892-7203914 TTGGAGCAGCCAGAGGAGGAAGG + Intronic
1143587257 17:7856448-7856470 CTGGAGCAGCAGCCGTGGGAGGG + Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144462249 17:15467596-15467618 TTGGGGCAGGGGCAAGAGGATGG - Exonic
1144771533 17:17762272-17762294 TTGGAGAAGACCCAGGAGGATGG + Intronic
1144876100 17:18398240-18398262 TTGGGGCAGCCCCAGGAGGAGGG - Intergenic
1145068007 17:19776642-19776664 TTTGAGTAGCCACAGGAGGATGG - Intronic
1145156128 17:20546180-20546202 TTGGGGCAGCCCCAGGAGGAGGG + Intergenic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1145760729 17:27424277-27424299 TTGGGGCAGCCCCAGGAGGAGGG - Intergenic
1145796535 17:27658765-27658787 TTGGAGCAGCAGCTGGGTGGGGG + Intergenic
1146160783 17:30558536-30558558 TTGGGGCAGCCCCAGGAGGAGGG - Exonic
1146533113 17:33627489-33627511 TGGCAGGAGCAGCAGCAGGAGGG - Intronic
1146630301 17:34464769-34464791 TGGGAGGAGTAGCAGGAGAAGGG - Intergenic
1146679956 17:34799919-34799941 TTAGAGAACAAGCAGGAGGAAGG - Intergenic
1146843598 17:36170269-36170291 TTGGGGCAGCCCCAGGAGGAGGG + Intronic
1146855905 17:36258207-36258229 TTGGGGCAGCCCCAGGAGGAGGG + Intronic
1146864715 17:36330168-36330190 TTGGGGCAGCCCCAGGAGGAGGG - Intronic
1146871811 17:36382118-36382140 TTGGGGCAGCCCCAGGAGGAGGG + Intronic
1146879172 17:36433200-36433222 TTGGGGCAGCCCCAGGAGGAGGG + Intronic
1146883106 17:36454346-36454368 TTGGGGCAGCCCCAGGAGGAGGG + Intergenic
1147067576 17:37930762-37930784 TTGGGGCAGCCCCAGGAGGAGGG - Intronic
1147074698 17:37982742-37982764 TTGGGGCAGCCCCAGGAGGAGGG + Intronic
1147079105 17:38010317-38010339 TTGGGGCAGCCCCAGGAGGAGGG - Intronic
1147086221 17:38062281-38062303 TTGGGGCAGCCCCAGGAGGAGGG + Intronic
1147095044 17:38134259-38134281 TTGGGGCAGCCCCAGGAGGAGGG - Intergenic
1147102167 17:38186246-38186268 TTGGGGCAGCCCCAGGAGGAGGG + Intergenic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147656754 17:42095490-42095512 ATGGGGCCGCAGCAGCAGGAGGG - Intergenic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148562046 17:48611878-48611900 TTGGGGGAGCAGGAGGAGAAGGG - Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1148852060 17:50560304-50560326 TTTGGGCAGCAGCCGGAGGACGG - Intergenic
1149174606 17:53854293-53854315 TTGGAGTAACAGAAGGAGAAGGG + Intergenic
1149304499 17:55335049-55335071 GTGGAGGAGCACCAGGAGGCAGG - Intergenic
1149374960 17:56034552-56034574 TTGGAGCAGAAGCAGCAGCTAGG + Intergenic
1149653292 17:58292491-58292513 TAGTGGCAGCAGCAGGAGAAGGG + Intergenic
1149657729 17:58319122-58319144 ATGGAGCAGCAGCAGGGGGGTGG + Exonic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1149846755 17:60012757-60012779 TTGGGGCAGCCCCAGGAGGACGG + Intergenic
1150085103 17:62269331-62269353 TTGGGGCAGCCCCAGGAGGAGGG + Intergenic
1150089440 17:62310017-62310039 GAGGAGGAGGAGCAGGAGGAAGG - Intergenic
1150285533 17:63951742-63951764 ATGCAGCAGCCCCAGGAGGAAGG + Exonic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150964023 17:69947225-69947247 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
1151456087 17:74226573-74226595 TCGGGACAGCAGCAGGAGAAGGG + Intronic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151757229 17:76081894-76081916 GAAGAGCAGCAGCAGCAGGATGG - Exonic
1151819738 17:76491053-76491075 CTGGACCAGCTGCAGGATGAGGG - Intronic
1151874804 17:76861554-76861576 TCGTGGCAGGAGCAGGAGGAAGG + Intergenic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152340306 17:79720744-79720766 ATGGAGCAGGAGCAGGAGCAGGG - Intergenic
1152415828 17:80161167-80161189 GAGGAGCAGCAGCAGCAGCAGGG + Intergenic
1152585184 17:81186121-81186143 CTGGAGCAGAAGCAGCGGGAAGG + Intergenic
1152775825 17:82201414-82201436 TGGAATCAGCAGCGGGAGGAGGG + Intronic
1152780961 17:82227290-82227312 GTAGAGCAGCAACAGGGGGAGGG - Intergenic
1152946246 17:83199074-83199096 TTGGGGCTGCAGCAGGGGGTCGG - Intergenic
1153057987 18:966874-966896 TTGGGGTGGCAGCAGGAGGGAGG + Intergenic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1153656108 18:7283804-7283826 TGGCAGTAGCACCAGGAGGAAGG + Intergenic
1154107443 18:11534562-11534584 CTGAAGCGCCAGCAGGAGGAGGG - Intergenic
1154149596 18:11895912-11895934 TAGAAACAGCAGCAGGAAGAAGG + Intronic
1154389502 18:13924285-13924307 TTGTAGCAGCACCTGGGGGAAGG - Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155505186 18:26526248-26526270 TTTGGGGAGCAGCAGGAGGAGGG + Intronic
1155505455 18:26528549-26528571 GCAGAGCAGCAGCTGGAGGAAGG - Intronic
1155777283 18:29780885-29780907 TTGGTAGAGCAGCATGAGGAAGG + Intergenic
1156361420 18:36387726-36387748 GTGGAGGAGCAGCAGGGAGATGG - Intronic
1156504747 18:37582698-37582720 ATGGTGCAGAAGCAGGATGAAGG - Intergenic
1156591230 18:38490945-38490967 GTGGAACAGGGGCAGGAGGAAGG - Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1156961092 18:43031944-43031966 ATGTAGCAGAAGCAGGTGGAAGG + Intronic
1157130353 18:45001591-45001613 TTTGAGGAGGAGCAGCAGGAAGG + Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157441777 18:47717158-47717180 ATGGATCAGCTGCAGGGGGAAGG + Intergenic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1157762696 18:50275898-50275920 ATGGGGCAGCTGCAGGAGGCAGG + Exonic
1157775159 18:50388772-50388794 CTTGAGCATCAGCAAGAGGAAGG - Intronic
1157972976 18:52292508-52292530 TTAGAGCAGGAACAGAAGGAAGG + Intergenic
1158247844 18:55452135-55452157 TTGGAACAGAGGCAGGGGGAAGG - Intronic
1158870257 18:61679920-61679942 TACGAGCAACAGAAGGAGGATGG - Intergenic
1159097465 18:63920552-63920574 TTGTAGTAGCAGCAGGAAGTGGG + Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1160033162 18:75279558-75279580 GAGGAGCTGGAGCAGGAGGACGG + Intronic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160143650 18:76347559-76347581 GAGGAGCAGGTGCAGGAGGAGGG - Intergenic
1160236954 18:77093288-77093310 TGGGAGCTGCAGCAGAGGGAAGG + Intronic
1160361873 18:78290202-78290224 ATGGAACACCAGCAGCAGGAGGG + Intergenic
1160641810 19:145382-145404 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1160845622 19:1164803-1164825 GAGGAGGAGGAGCAGGAGGAGGG + Intronic
1160972119 19:1774175-1774197 TAGGGGCAGGAGCAGGAGGCAGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161021057 19:2011747-2011769 GAGGAGCAGGAGCAGGAGGGTGG - Intronic
1161085439 19:2332960-2332982 TGGGAGGGGGAGCAGGAGGAGGG + Intronic
1161085460 19:2333021-2333043 TGGGAGGGGGAGCAGGAGGAGGG + Intronic
1161085498 19:2333142-2333164 TGGGAGGGGGAGCAGGAGGAGGG + Intronic
1161279360 19:3436969-3436991 TGGGAGCTACAGGAGGAGGAAGG + Intronic
1161287995 19:3478690-3478712 TTGGAGGAGCAGCAGGGAAATGG + Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161795054 19:6381562-6381584 AAGGCGCCGCAGCAGGAGGAGGG - Exonic
1162066575 19:8129385-8129407 TGTCAGCAGCAGCAGAAGGAGGG + Intronic
1162289536 19:9768560-9768582 CCGGAGCAGCAGCGGGAGGCCGG + Exonic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1163013538 19:14440312-14440334 TCGGAGCAGGAGCTGGAGGTGGG + Exonic
1163244755 19:16086558-16086580 ATGGCGCAGCAGCAGGAAGTGGG + Intronic
1163364734 19:16869614-16869636 CTGGTGCAGCAGCTGGTGGATGG - Exonic
1163423463 19:17227916-17227938 TTGGAGCTCCAGCACGAGGTGGG + Exonic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1163737697 19:18991488-18991510 TTGGAGGAGCGGCAGGAGGTGGG + Intronic
1164719866 19:30424256-30424278 TTGGAGCAGGAGCACTAGGTGGG + Intronic
1164769820 19:30799954-30799976 CTCGTGCAGCAGGAGGAGGAGGG - Intergenic
1164834371 19:31348543-31348565 TGGGAGCAGCAGTACAAGGAGGG + Intronic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165069898 19:33249106-33249128 TGGGAGAAGCAGCAGGCGGGGGG + Intergenic
1165370466 19:35402481-35402503 TAGGGGCAGCAGCTGGTGGAGGG + Intergenic
1165384605 19:35502942-35502964 ATAGGGCAGTAGCAGGAGGAGGG - Intronic
1165741649 19:38208439-38208461 TGGGGACAGGAGCAGGAGGAGGG - Intergenic
1166054283 19:40279335-40279357 TGGGAGCAGGACCAGGAGGGAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166396158 19:42442791-42442813 TAGTGGCAGCAACAGGAGGAGGG + Exonic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167249090 19:48391293-48391315 TTTGAGCAGTAGCAAGATGATGG + Exonic
1167300331 19:48674084-48674106 GTGCATCAGCTGCAGGAGGATGG + Intergenic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168121079 19:54252923-54252945 GAGGAACAGCAGCAGGACGAAGG + Exonic
1168255056 19:55160663-55160685 GAGGAGCAGCAGCACGCGGAGGG - Exonic
1168266561 19:55226851-55226873 TCAGAGCAGCAGCAGGGGGCGGG + Exonic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925421211 2:3713431-3713453 GTGGAGCAGCAGAGGGGGGAAGG - Intronic
925484176 2:4309913-4309935 TTGGAGTAGTTTCAGGAGGAAGG + Intergenic
925525949 2:4802575-4802597 TGGGAGGAGGAACAGGAGGAAGG + Intergenic
925746917 2:7051321-7051343 TTGGAGGTGGAGCAGGTGGACGG + Intronic
925831372 2:7899269-7899291 TATGAGTAGGAGCAGGAGGAAGG - Intergenic
925834046 2:7925680-7925702 TTGGAGCAGCCTCAGGATGGTGG + Intergenic
926005873 2:9373185-9373207 CTGGAGCCGGAGCAGGAGGGAGG + Intronic
926166483 2:10524433-10524455 GTGGAGGAGCAGCAGCTGGAGGG + Intergenic
926318786 2:11733187-11733209 TTGGATCAGCTGCAGGGGGAAGG - Intronic
926383555 2:12314585-12314607 GAGATGCAGCAGCAGGAGGAGGG - Intergenic
926434708 2:12826092-12826114 TTGGAGTAGCAGCATGAACAAGG - Intergenic
927496329 2:23554082-23554104 CTGGAGCAGCCCCAGGAGGCAGG + Intronic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927633496 2:24793984-24794006 TTTGGGCAGCAGCAGGAAGGAGG - Intronic
927640106 2:24840721-24840743 TTGGAGCAGGGGCAAGAGTAGGG + Intronic
927853114 2:26512145-26512167 TTTGGGCAGCAGAAGGAGGTGGG + Intronic
928619182 2:33071539-33071561 TTGGAGCAGGAACAGGGGGAAGG + Intronic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929626904 2:43418749-43418771 TTTGAGAGGCAGCGGGAGGAAGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930189796 2:48445709-48445731 TGGGAGCAGGAGCAGGAGAAAGG + Intronic
930801835 2:55450819-55450841 TTAAAGCAGCAGCAGAAGAAGGG - Intergenic
930802331 2:55455921-55455943 TTAAAGCAGCAGCAGAAGAAGGG - Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932453920 2:71834251-71834273 CTGGAGCTGCTGGAGGAGGATGG + Intergenic
932460987 2:71881893-71881915 TTGGTGCAGGAGCAGGAGCCAGG + Intergenic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
933649627 2:84840112-84840134 TGGAAGCAGCAGCAGCAGGCAGG - Intronic
933773819 2:85759842-85759864 TTGGCACAGAAGCAGGAGCATGG + Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934653104 2:96103550-96103572 TATGAGGAGCAGCAGCAGGAGGG - Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935922164 2:108027880-108027902 TGGAACCAGCAGCAGGAGGCTGG - Intergenic
935944545 2:108273563-108273585 AAGGAGCAGCAGCACGAAGAGGG - Intergenic
935958686 2:108402708-108402730 TTCGAACAGCAGAAAGAGGATGG + Intergenic
936087717 2:109480625-109480647 TGGGAGGAGGAGGAGGAGGATGG + Intronic
936111924 2:109671570-109671592 TTCAGGCACCAGCAGGAGGAGGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936538664 2:113332431-113332453 TAGGAGGAGCCACAGGAGGATGG - Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936659240 2:114523805-114523827 TGGGATGAGCAGCAGGTGGAGGG - Intronic
937791460 2:125967052-125967074 TTGGAGCAGAAGGAGGAGATTGG - Intergenic
937922719 2:127143225-127143247 TTGGAGGAGCAGAAGGATGGTGG - Intergenic
937972780 2:127563585-127563607 TTGCTGCAGCAGTAGGAGCAAGG - Intronic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938409066 2:131048843-131048865 TGGGCGCAGCAGCAGGTGGCAGG - Exonic
939992091 2:148885376-148885398 GTGAAGCAGCAGCAGGGAGAAGG - Intronic
940748564 2:157597612-157597634 TGGCAGCAGAAGCAGGAGGCAGG + Intronic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941234748 2:162957128-162957150 TTGTAGCAGAAGCTGGAGGAGGG - Intergenic
941463288 2:165795159-165795181 TTGTTGCAGCAGCAGAAGGAAGG - Intergenic
941670121 2:168284040-168284062 TTCCAGCAGCTGCAGGGGGAGGG - Intergenic
942254270 2:174078062-174078084 TTGGAACACCAGGAAGAGGAGGG - Intronic
942659121 2:178245711-178245733 TTGGAGCAGCTTGGGGAGGAGGG + Intronic
942898379 2:181085748-181085770 TAGGAGCAGCATAAGAAGGAAGG + Intergenic
942985412 2:182134778-182134800 GAGGAGGAGCAGCAGGATGAGGG + Intergenic
943458252 2:188135559-188135581 TTAATGCAGCAGCAAGAGGAGGG - Intergenic
943641211 2:190360182-190360204 TTCGATCAGCAGCTGGAAGAGGG - Exonic
943687060 2:190829755-190829777 TAGGAGCAGGAGCAAGAGGGTGG + Intergenic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945023753 2:205600306-205600328 TTGGAGGAGCAGCAGGTTTAGGG + Intronic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
946400669 2:219466767-219466789 TTGGTGCAGGAGCAGGGGCAGGG + Intronic
946405256 2:219488924-219488946 TTGGGGGAGCGGCAGGGGGAGGG + Intronic
946431977 2:219631011-219631033 TGGCAGCAGTAGCAGCAGGATGG + Intronic
946434270 2:219641576-219641598 TTGGAGGAGGAGCTGGAGAATGG + Intronic
946765421 2:223036002-223036024 TTGGAGGAGAAGCTGGAGGGTGG - Intergenic
946767360 2:223053030-223053052 TTTGTACAGCAGCAGGAGGCTGG - Exonic
946908523 2:224438660-224438682 TGGGAGGAGGAACAGGAGGAAGG - Intergenic
946939763 2:224758534-224758556 TTGTAGCAGCAGTAGCAGGTGGG + Intergenic
947103445 2:226645826-226645848 TTGGAGCAGCAGCAATAGGTTGG - Intergenic
947399052 2:229714349-229714371 TCCGAGCAGCAGCAGCAGCAGGG + Exonic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948022768 2:234749966-234749988 TTGGGGCTGAAGCAGGAGAATGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948247812 2:236501145-236501167 CGGGAGCAGGAGCAAGAGGAAGG + Intronic
948358129 2:237396974-237396996 TTGAACCAGCAGCAAAAGGATGG + Intronic
948454914 2:238100471-238100493 TTGGAGCGGCTGCTGGAGGCTGG + Exonic
948599160 2:239098386-239098408 CAGGAGCAGCAGCGAGAGGATGG - Intronic
948672465 2:239577272-239577294 TTGAAGCTGCAGCAGGAAGCGGG + Intergenic
948701201 2:239761552-239761574 TTGGGGCAAAAGCAGAAGGATGG - Intergenic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169506889 20:6220770-6220792 TTGGGGCAACTCCAGGAGGAAGG + Intergenic
1169688692 20:8305969-8305991 TGGGAGCAGCAGCAGATGGTGGG + Intronic
1169745574 20:8939211-8939233 TGAGAGCAGCACCAGGAGGATGG + Intronic
1170711018 20:18791097-18791119 TTGCAGCAGAGGCAGGAGAAGGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173819452 20:46011129-46011151 TTGGAACCACTGCAGGAGGAGGG - Exonic
1173997053 20:47346439-47346461 GGGGAGCAGCAGGAGGAGGCTGG - Intronic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1175351357 20:58322035-58322057 GTGAAGCCACAGCAGGAGGATGG - Intronic
1175501060 20:59451160-59451182 TAGAAGCAGCAGCAGCAGCAAGG - Intergenic
1175644421 20:60658825-60658847 TCGGGGGAGCAGCAGGGGGAGGG + Intergenic
1175868718 20:62196563-62196585 TTGGGGCTGAAGCAGGAGGATGG + Intronic
1176093273 20:63328387-63328409 TTGGAGCAGAAGCTGGAGCCGGG + Exonic
1176660400 21:9629736-9629758 TTAAAGCAGCAGTAGGAGGCAGG - Intergenic
1178355772 21:31909579-31909601 TTAGCTCAGCAGCAGGAGGGTGG + Intronic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178580166 21:33831592-33831614 TTGGAACAGCAGGAGCAGGAAGG + Intronic
1178691511 21:34754124-34754146 TGGGGGCAGCAGTAGGAGGTGGG - Intergenic
1178840646 21:36135331-36135353 GTGCAGCAGCTGCAGGCGGAGGG + Exonic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179515963 21:41907103-41907125 TTGCAGCAGGAACAGGGGGAGGG + Exonic
1179652137 21:42818438-42818460 GAAGCGCAGCAGCAGGAGGAGGG + Intergenic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1180149256 21:45939362-45939384 TTGAAGCAGCTGAGGGAGGAGGG - Intronic
1180211827 21:46299501-46299523 TGGGAGCAGAAGGATGAGGACGG - Intergenic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1180922053 22:19526047-19526069 ATGGGTCTGCAGCAGGAGGAAGG - Intronic
1181276104 22:21688373-21688395 TTGGAGAGGCTGCAGGAGGGAGG - Intronic
1181382138 22:22514283-22514305 TTGGAGGCACAGCAGAAGGAGGG - Exonic
1181786029 22:25227931-25227953 ATGGACCAGCAGCCGAAGGACGG + Exonic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182522471 22:30892183-30892205 TTAGAGGAGGAGCATGAGGAGGG + Intronic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1183602399 22:38847553-38847575 TTGGAGAAGCACCTGGAGGGAGG - Intergenic
1184092504 22:42299895-42299917 TTGGAGCGGGTGGAGGAGGAGGG + Intronic
1184298091 22:43538801-43538823 TTACAGCAGCAGTAGGAGGCTGG - Intronic
1184591017 22:45483367-45483389 ATGTAGCAGCAGCAGTGGGAAGG - Intergenic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184712762 22:46262876-46262898 TCCGAGCAGCCGCAGGCGGAAGG + Exonic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184895928 22:47406433-47406455 TTGGGGCAGCGTCAGGAGGTTGG - Intergenic
1184953910 22:47867810-47867832 TTAGAGCAGCAGCAAGAAAATGG - Intergenic
1185178375 22:49344831-49344853 CTGGAACAGAAGCGGGAGGAGGG + Intergenic
1185188538 22:49418009-49418031 GGGGAGCAGCACCAGGAAGACGG + Intronic
1185330243 22:50249115-50249137 TGGGAGCAGCAGGTGCAGGAAGG + Exonic
1185413671 22:50698406-50698428 TGGGGGCAGCAGCAGGAGTGTGG + Intergenic
949494856 3:4621846-4621868 TTGGAGTTGCAGGAGGAGAAAGG - Intronic
949518350 3:4827176-4827198 TCGGGGCAGGAGCAGGAGGGTGG - Intronic
949607036 3:5664547-5664569 TGGGAGCAGGAGCAAGAGAAGGG + Intergenic
949920931 3:9000018-9000040 TTGGAGCAGGAGTAGAGGGAGGG - Intronic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
950575970 3:13832240-13832262 TGGGAGCAAGAGGAGGAGGAGGG - Intronic
950595674 3:13979160-13979182 ATGGAGCAGAAGCAGGAAGCAGG - Intronic
951998452 3:28757209-28757231 CTGGAGCAGCGGCGGGAGGCAGG + Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
952925891 3:38318944-38318966 TTGCAGCATCAGCAGAAAGATGG - Intergenic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
953563449 3:44012390-44012412 GAGGAGCAGCAGCAGTAGGCTGG - Intergenic
953865257 3:46577803-46577825 TCGTAGCAGAAGCAGGAGCAAGG - Exonic
954121844 3:48504229-48504251 GGGGAGCAGGAGGAGGAGGAGGG + Exonic
954263991 3:49459464-49459486 TGGGAACAGCTGCAGGAAGAGGG + Intergenic
954386352 3:50246101-50246123 GGGGAGCAGCACCTGGAGGAAGG + Intronic
954592611 3:51796510-51796532 TTTGTGCAACAGCAGAAGGAAGG - Intergenic
954796711 3:53165162-53165184 TTGTAGCAGCAGCGGGAGCCAGG + Intronic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
956290418 3:67654645-67654667 GAGGAGGAGCAGCGGGAGGAGGG + Intergenic
956308865 3:67856934-67856956 ATGGACCAGCAGCAGCAGCATGG + Intergenic
957830395 3:85509227-85509249 TGGGGGCAGTAGCAGGAAGAGGG + Intronic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959427533 3:106210136-106210158 TTCGAGCATGAGCAGGAGCAAGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
962173974 3:133133152-133133174 TTGATGCAGCAGCAGCAGCAGGG + Intronic
962592722 3:136907134-136907156 CTGCTGCAGCAGCAGGAGCAAGG - Intronic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
963785614 3:149531553-149531575 TTGGCGCAGGTGCAGGAGGTGGG - Intronic
964170579 3:153765493-153765515 TGGGAGCACCAGCAGGAGACTGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965376665 3:167932701-167932723 GTGGGGCTGAAGCAGGAGGATGG + Intergenic
965550461 3:169959780-169959802 GGGCAGCAGCAGCAGGAAGATGG - Intergenic
965551267 3:169967071-169967093 GTGGAGCAGCAGGGGAAGGAAGG + Intronic
965673477 3:171171392-171171414 TTGGAGCAAAAGCAGGAGGCTGG + Intronic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
967135493 3:186509558-186509580 TAGAAGCAGAAGCAGAAGGAAGG - Intergenic
968331008 3:197870173-197870195 TAGGTGCAGCAGATGGAGGAAGG - Exonic
968332701 3:197885176-197885198 TCTGAGGAGCAGCAGGAGGGCGG - Intronic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
969532008 4:7735343-7735365 TGGGACCGGGAGCAGGAGGAGGG - Intronic
969721508 4:8895030-8895052 GGGGAGCAGCAGCAGGACAAGGG - Intergenic
970195578 4:13547600-13547622 GCGGAGGAGAAGCAGGAGGAGGG - Intergenic
971714186 4:30153831-30153853 TTGGAGCAGAACCAGGAGTGGGG + Intergenic
973530897 4:51835961-51835983 GTGGAGCAGTGGGAGGAGGAAGG - Intergenic
973673654 4:53241755-53241777 ATGGTGGTGCAGCAGGAGGAGGG - Intronic
974671755 4:65039172-65039194 TTGCACCAGCTGCATGAGGATGG + Intergenic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975814705 4:78205722-78205744 TGGGAGCAGCAGCAGGAAGAGGG + Intronic
975888241 4:78991811-78991833 AGAGAGCAGCAGCAGGAGGCTGG + Intergenic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977241877 4:94581303-94581325 GTGGAGCGGCAGCAAGTGGAGGG - Intronic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
979375467 4:119941556-119941578 TAGGAGTAGCAGCAGAAGAAGGG - Intergenic
979611240 4:122691100-122691122 TGAGAGCAGCAGCAGGAACAGGG - Intergenic
979993676 4:127405721-127405743 TTTGAGCAAAAGCAGGAGCAGGG - Intergenic
980114102 4:128662869-128662891 TTTGAGAAGGAGCAGCAGGAGGG - Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982740118 4:159048568-159048590 TTGGACCAGAAGCAGGGGGAGGG + Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983639994 4:169936259-169936281 TGGGAGCAGGTGCAGGTGGAAGG - Intergenic
983660700 4:170128050-170128072 ATGGTGCAGCAGCAGGCTGAAGG + Intergenic
984392593 4:179155905-179155927 TGTGTGCAGCAGCAAGAGGAGGG + Intergenic
984713638 4:182905975-182905997 TAGGGGCAGCATCAGGAAGATGG - Intronic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985233738 4:187849996-187850018 TTGGAGCAGAAACAGAAGGCTGG + Intergenic
985414957 4:189726681-189726703 TTAAAGCAGCAGTAGGAGGCAGG + Intergenic
985656427 5:1133881-1133903 GTGGAGCTGCAGCTGGAGGTGGG + Intergenic
985754989 5:1708576-1708598 TTGGGACAGCAGCAGGGGGCTGG - Intergenic
986782800 5:11082778-11082800 TCGGAGCAGCTCCACGAGGATGG + Exonic
986806547 5:11313254-11313276 TTGGGGCAGCAGCAGGAAACAGG + Intronic
987034567 5:14006889-14006911 TGGAGGCAGCAGCAGGAGGCAGG - Intergenic
987064995 5:14281305-14281327 TTGGAGCAGGAGGAAGAGGGTGG + Intronic
987091207 5:14509155-14509177 TTGGGGCAGGAACAGGGGGAGGG - Exonic
987092927 5:14523441-14523463 TGGGAGCACCAGCAGGAGGAAGG - Intronic
988617746 5:32792238-32792260 TGGCAGCAGCAGCAGGATCAGGG - Intergenic
988660462 5:33261582-33261604 TTGGAGGAGGAGGAGGAGGTGGG + Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989068921 5:37490294-37490316 TTGCAGCAGCAGTAGTAGGCAGG + Intronic
989134152 5:38136522-38136544 TGGCAGCAGCAATAGGAGGATGG - Intergenic
991553735 5:67872097-67872119 TTGGAAGAAGAGCAGGAGGAGGG + Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992577057 5:78124468-78124490 TGGGAGCTGAGGCAGGAGGATGG + Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993249547 5:85501132-85501154 CTAGAGCAGCAGGAAGAGGATGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994080737 5:95706397-95706419 TTGTGGCTGGAGCAGGAGGAAGG - Intergenic
994081620 5:95713470-95713492 TTGTGGCTGGAGCAGGAGGAAGG - Intergenic
994616833 5:102114711-102114733 TAGAAGCAGCAGGAGGTGGAGGG + Intergenic
995350824 5:111173459-111173481 AAGGAACAGCAGCAGAAGGAAGG + Intergenic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
995753793 5:115480301-115480323 TAGTAGCAGAAGCAGGAGGAAGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
996882668 5:128317703-128317725 TTGGAGCAGAAGAAGTTGGAAGG - Intronic
996903899 5:128575893-128575915 TTGTAGCAGGAGCAAGAGCAGGG - Intronic
997512963 5:134465923-134465945 TCGGAGCAGGACGAGGAGGAGGG - Intergenic
997569815 5:134917705-134917727 CTGGAGCTGCAGCGGGAGGGAGG + Intronic
998102914 5:139449166-139449188 GTGGAGCAGCTGGGGGAGGAAGG + Exonic
998395023 5:141812678-141812700 GAGGAGGAGGAGCAGGAGGAGGG + Intergenic
998400294 5:141845322-141845344 GTGGAGGAGGAGCAGGGGGAGGG - Intergenic
998461653 5:142314420-142314442 TTGGAGCGGGAGCAGGAGCAGGG + Exonic
998610784 5:143685856-143685878 TTAGAGGAGTAGGAGGAGGATGG + Intergenic
998821012 5:146057836-146057858 TTGGGGCTGAGGCAGGAGGATGG + Intronic
999055177 5:148567166-148567188 TTGTAGCAGCTTCAGGTGGATGG - Intronic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600113 5:172923131-172923153 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1001600127 5:172923190-172923212 TGGGAGGAGGAGGAGGAGGAGGG + Intronic
1002130632 5:177079464-177079486 TTTGTGCAGAGGCAGGAGGAAGG - Intronic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002401056 5:178991785-178991807 TTGGGGCAGAAGCAGAAAGATGG - Intronic
1002522850 5:179800977-179800999 TTGGGGCAGCAGCAGGGCTAAGG - Intronic
1002701573 5:181128547-181128569 TGGGAGCAGCTCCAGGAGGCAGG - Intergenic
1002735050 5:181379102-181379124 TCGGAGGAGCAGGAGGAGTAAGG - Intergenic
1002749476 6:95020-95042 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1002919719 6:1558664-1558686 TGGGAGCAGGAGCAGGGGGCGGG - Intergenic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003115856 6:3283625-3283647 TCCAGGCAGCAGCAGGAGGAAGG - Intronic
1003226694 6:4212390-4212412 TTGCAGTAGCTGGAGGAGGAAGG - Intergenic
1003293812 6:4805999-4806021 CTGGCGCAGGAGCATGAGGAAGG + Intronic
1003425565 6:5996266-5996288 TTGGAACAGCAGTAGGAGCCAGG + Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1003990708 6:11483587-11483609 AGGGAGCAGAAACAGGAGGAGGG - Intergenic
1004167124 6:13266677-13266699 TTGGAGGAGCAGGAGCAAGAGGG + Exonic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004949442 6:20652103-20652125 TTGGAGTAGTTTCAGGAGGATGG + Intronic
1005384956 6:25277191-25277213 TTGCAGCAGTAGCAGTAGAAGGG + Intergenic
1005495450 6:26383862-26383884 GAGGAGCAGGAGGAGGAGGAGGG - Exonic
1005583620 6:27255191-27255213 TTTCAGCACCAGCAGAAGGAGGG - Intronic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005821230 6:29601180-29601202 TCAGAACAGCAGCAGGAGGCTGG - Intronic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1005854517 6:29850591-29850613 CTGCAGCAGCGACAGGAGGAGGG - Intergenic
1006183175 6:32166209-32166231 TGGTATCAGTAGCAGGAGGAAGG - Exonic
1006308046 6:33236770-33236792 TGAGAACAGCACCAGGAGGATGG - Intergenic
1006444131 6:34069433-34069455 CTGGAGCAGCCGCATGGGGAGGG - Intronic
1006478568 6:34273711-34273733 TTGGAGCAGGTGGAGGAGGTGGG - Intergenic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1007118628 6:39362297-39362319 CTAGAACAGCAGGAGGAGGAGGG - Intronic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007417510 6:41700680-41700702 TCTGAGCACCAGCAGGAGGTGGG + Intronic
1007701966 6:43770968-43770990 GAGGAGCCGCAGCCGGAGGAGGG + Exonic
1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG + Intronic
1007838202 6:44693813-44693835 TTGGAGCAGCAACAGAATGTCGG + Intergenic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010985136 6:82414855-82414877 CTGGAGGAGCAGCAGTGGGAGGG + Intergenic
1011398737 6:86937464-86937486 GAGGAGCAGGAGCAGGAGCATGG - Exonic
1012847976 6:104413602-104413624 TTAGAGCTGCAGCAGGAGTCTGG + Intergenic
1013373464 6:109490904-109490926 TTGGGGCAGCAGCTGGAGGATGG + Intergenic
1014152044 6:118068329-118068351 TTAGAGCAGCAGCCGCAGTATGG + Intronic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1015891462 6:137973763-137973785 TTGGAGCAGGGGGTGGAGGATGG + Intergenic
1015988894 6:138914714-138914736 TTGGAGGCACTGCAGGAGGATGG + Exonic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1017037584 6:150280367-150280389 GTGGAGGAAGAGCAGGAGGAAGG - Intergenic
1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG + Intergenic
1017300775 6:152855429-152855451 TGGGAACAGGAGTAGGAGGAGGG - Intergenic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1017949127 6:159120892-159120914 CTGAAGCAATAGCAGGAGGAAGG - Intergenic
1018582791 6:165322097-165322119 TTGGAGGAGAAGCATTAGGAAGG - Intergenic
1018860141 6:167705318-167705340 GCCGAGCAGCAGTAGGAGGAGGG + Intergenic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1019057279 6:169232583-169232605 TCAGAAAAGCAGCAGGAGGAAGG - Intronic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1019239309 6:170651419-170651441 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1019520461 7:1458608-1458630 TGGGAGCAGCAGGAGGTGGCAGG - Intronic
1019614852 7:1954570-1954592 TTGGTGCAGCCGCAGGAGTCAGG - Intronic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019783470 7:2958656-2958678 TTGGAGCAGGAGGCGGAGGATGG + Intronic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1019959826 7:4449804-4449826 AGGGGGCAGCAGCAGGAGCAGGG - Intergenic
1021163516 7:17305112-17305134 ATAGGGCAGCAGCAGGAGGGTGG + Intronic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1022151126 7:27607708-27607730 TTAGATAAGCAGCTGGAGGAAGG - Intronic
1022363942 7:29690997-29691019 TTGGTTCAGCAGCAGAAGGATGG - Intergenic
1022504620 7:30902571-30902593 TTGGAGCAGAAGCGGGACTAAGG - Intergenic
1022697425 7:32722732-32722754 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1022794659 7:33722530-33722552 CTGGGGCAGCAGCAGGCAGAAGG - Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1022934681 7:35161234-35161256 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1024019130 7:45349209-45349231 CTGGAGGATCACCAGGAGGATGG + Intergenic
1024638185 7:51307973-51307995 TTTAGGCAGGAGCAGGAGGAAGG + Intronic
1024674575 7:51626720-51626742 GGGAAGCAGCAGCAGGAGGGAGG - Intergenic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024837682 7:53542711-53542733 TAGGAGCTGCACCAGGAGCAAGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027596791 7:80184239-80184261 TTAGAGCAGGAACAGAAGGAAGG + Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028076851 7:86527094-86527116 TTGGACCAGCAGAAGGATGGAGG - Intergenic
1029173915 7:98650381-98650403 TTGGAGCATCAGAAGGGAGAAGG + Intergenic
1029830622 7:103254014-103254036 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030320750 7:108164573-108164595 GAGGAGCAGGAGCAGGAGCAGGG + Intronic
1031368608 7:120935825-120935847 ATGTAGCAGAAGCAGGAGGTAGG + Intergenic
1031518687 7:122735640-122735662 TTGGATCAGCAGGGGGATGAGGG - Intronic
1031780784 7:125961458-125961480 ATGGAACAGCAGGAGGAGGGAGG - Intergenic
1032124941 7:129186958-129186980 TGAGAGCAGCACGAGGAGGATGG + Intergenic
1032401592 7:131628064-131628086 TTGGAGCAGTATCACGTGGAGGG - Intergenic
1032510929 7:132471713-132471735 TTGGAGTGGGAGGAGGAGGAGGG + Intronic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1032809274 7:135394164-135394186 TTGTAGCTGCAGCAGGATGCAGG + Exonic
1033224440 7:139549432-139549454 TTGCACCAGAAGCAGGTGGAGGG + Intergenic
1033439655 7:141367147-141367169 GTGGACCAGCAGAGGGAGGAAGG + Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1034016748 7:147596020-147596042 TTGGAGCTGCAGCATGAAGACGG - Intronic
1034282390 7:149863317-149863339 TGGGAGCAGCAACAGCCGGAAGG - Intronic
1034282398 7:149863372-149863394 TGGGAGCAGCAACAGCCGGAAGG - Intronic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1035110942 7:156481221-156481243 GTGGAGCTGCAGCAGGAGCTGGG - Intergenic
1035160337 7:156945188-156945210 TTGGAGGAGGAGGAGGGGGAGGG - Intergenic
1035508461 8:155189-155211 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035743909 8:1947795-1947817 TTCGAGCAGCAGCAGTAGGGAGG - Intronic
1035760308 8:2064136-2064158 ACGGAGCAGATGCAGGAGGAAGG - Intronic
1035812432 8:2504021-2504043 TTGGAACAGCAGTAACAGGAGGG - Intergenic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1037828914 8:22176950-22176972 TAGGAGCAGCACCTGGAGGGCGG - Exonic
1038164075 8:25067825-25067847 TTGGAGCAGCAGCTTGAGCTGGG - Intergenic
1038670015 8:29575346-29575368 CTGAAACACCAGCAGGAGGAAGG - Intergenic
1038825013 8:30990340-30990362 TAGGACCAGCTACAGGAGGAGGG + Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1039467715 8:37796406-37796428 TGGAGGCAGCCGCAGGAGGATGG - Intronic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1039725143 8:40207302-40207324 TGGGAGCAAGAACAGGAGGAAGG - Intergenic
1040008701 8:42642900-42642922 CTGGGGCAGCAGCAGGGGGCAGG - Intergenic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040487637 8:47888930-47888952 CAGGAGCAGCTGCAGGAGCACGG + Intronic
1040565716 8:48564909-48564931 GGGGAGCAGGAGCAGGGGGAAGG + Intergenic
1041600480 8:59711674-59711696 TTGGATCATCAGCAGAAGCAGGG + Intergenic
1041726842 8:61026030-61026052 TTGGAGGGGTAGCAGGGGGAGGG - Intergenic
1042312076 8:67388798-67388820 TGGCAGGAGCAGGAGGAGGAGGG - Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1042836012 8:73079638-73079660 TTGGGGGAGAAGGAGGAGGAGGG - Intronic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043310077 8:78847935-78847957 TTGCAGCAGAAGCAGGTGGGGGG + Intergenic
1043464088 8:80487419-80487441 CTGCAGCAGCAGCAGGCGGTCGG + Exonic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044252413 8:90019369-90019391 TTGAAGCAGCAGCAGTGGAATGG + Intronic
1044893530 8:96863213-96863235 TTGGAGCAGGGGGAGGATGATGG + Intronic
1044916035 8:97113305-97113327 AGAGAGCAGCAGCAGGAGAAGGG + Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047852836 8:128877560-128877582 GTGGAGGAGAGGCAGGAGGAGGG + Intergenic
1048072903 8:131040367-131040389 TTGGGGAGGCAGCCGGAGGAGGG + Exonic
1048163436 8:132041145-132041167 TGGAAGCAGCAGCTGTAGGAAGG + Exonic
1048572484 8:135667295-135667317 ACTGAGCACCAGCAGGAGGAGGG - Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048817267 8:138345411-138345433 TTGTAGCAGCAGCAGGGCCAGGG + Intronic
1048887425 8:138919530-138919552 TTGGGGCTGCTGCAGTAGGAGGG - Intergenic
1048987290 8:139741330-139741352 TTGGAGCAGCCCCAGTAGGAGGG + Intronic
1048989707 8:139754145-139754167 ATGGAGCAGCAGCAGGCTGGGGG - Intronic
1049058447 8:140257389-140257411 TTGGAGGAGAAGTAGAAGGAAGG - Intronic
1049092940 8:140530397-140530419 AGGGAACAGCAGCAGGAAGAGGG + Intergenic
1049420617 8:142514937-142514959 TTGGGGCAGTGGCAGGACGAAGG + Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1050033985 9:1415618-1415640 TGGGAGCAGGAGGAGGTGGAAGG + Intergenic
1050315830 9:4399951-4399973 TTGGAGCAGAAATAGGAGGTGGG + Intergenic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1052750321 9:32483511-32483533 TTGGGGAAGTAGCAGAAGGATGG - Intronic
1052968769 9:34363625-34363647 AGAGAGCAGCAGCAGGGGGAAGG - Intergenic
1056109178 9:83377623-83377645 TGGGAGCAGGAGCAGGAGAGAGG - Intronic
1056224749 9:84483851-84483873 TTGGAGCTGCTGCAGGAGCCGGG + Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056968381 9:91183003-91183025 CTGGTGCAGGAGCAGGAGGGAGG - Intergenic
1057039283 9:91835727-91835749 TTGCAGCTGCAGGAGGCGGAAGG + Intronic
1057164874 9:92917549-92917571 TTGGAGCTGGAGCAGGAACAAGG - Intergenic
1057325858 9:94062606-94062628 TGGGAGCAGGAGCAGGAGGAAGG + Intronic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057444334 9:95103446-95103468 GTGGCCCAGCAGCAGGAGGCAGG + Intronic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1058593636 9:106591570-106591592 GGGGAGGAGCAGCAGGAGGTGGG + Intergenic
1058924014 9:109643972-109643994 TGGGAGCAGGAGCAAGAGCAAGG + Intronic
1059362756 9:113758475-113758497 TGGGAACAGCACTAGGAGGATGG + Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060222493 9:121772102-121772124 AGGGAGCGGCAGCAGGAGGCTGG + Intronic
1060931649 9:127492836-127492858 TTTGAGCAGCTGCTGGAGCAGGG - Exonic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061267027 9:129512159-129512181 TTGGAGGAGGCACAGGAGGAGGG + Intergenic
1061329086 9:129881031-129881053 TTGGAACACCAGGAGGAGGTTGG + Exonic
1061372723 9:130206849-130206871 TGGGAGCGGCAGTAGGAGGGAGG + Intronic
1061418918 9:130462792-130462814 TTTGAGCAGCCCCAGGAGGCAGG - Intronic
1062403878 9:136384352-136384374 GTGGGGCAGCAGGAGGAGCACGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1062759517 9:138331710-138331732 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1203779992 EBV:95963-95985 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203779998 EBV:95981-96003 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780016 EBV:96026-96048 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780022 EBV:96044-96066 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780036 EBV:96080-96102 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780042 EBV:96098-96120 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780052 EBV:96125-96147 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780066 EBV:96161-96183 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780072 EBV:96179-96201 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780082 EBV:96206-96228 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780096 EBV:96242-96264 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780120 EBV:96308-96330 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780176 EBV:96461-96483 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780186 EBV:96488-96510 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780223 EBV:96587-96609 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203599964 Un_KI270748v1:2482-2504 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1203637970 Un_KI270750v1:131579-131601 TTAAAGCAGCAGTAGGAGGCAGG - Intergenic
1185714475 X:2330177-2330199 GAGGAGGAGAAGCAGGAGGAGGG + Intronic
1186313164 X:8342082-8342104 GAGGAGGAGAAGCAGGAGGAGGG - Intergenic
1186393991 X:9189457-9189479 TGAGAGCAGCAGCTGGAGGAGGG - Intergenic
1186393997 X:9189504-9189526 TAAGAGCAGCAGCTGGAGGAAGG - Intergenic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1186833870 X:13418233-13418255 TTGCAGCAACAGCAGACGGATGG - Intergenic
1186930904 X:14388923-14388945 TTATAGCAGCAGTATGAGGAAGG - Intergenic
1187171867 X:16860127-16860149 TTGGAGCAGTCTCAGGAGGGAGG - Intronic
1189244736 X:39554728-39554750 TTTGAGGAGCAGCAGGGGAAAGG - Intergenic
1189557115 X:42156231-42156253 TAGGAGTAGGAGCAGAAGGAAGG + Intergenic
1190282528 X:48940468-48940490 TTGGAACATCAGCACTAGGAGGG - Intronic
1190598527 X:52068216-52068238 GTGAAGCAGCTGCAGGGGGAGGG + Exonic
1190610297 X:52185857-52185879 GTGAAGCAGCTGCAGGGGGAGGG - Exonic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1191846314 X:65550412-65550434 GTGGAGCACTACCAGGAGGAAGG + Intergenic
1192656894 X:73002697-73002719 TGGGAGCAGGAGCGGGAGCAGGG - Intergenic
1192665226 X:73080304-73080326 TGGGAGCAGGAGCGGGAGCAGGG + Intergenic
1192903422 X:75523594-75523616 TTCAAGCAGCAGTGGGAGGATGG - Intergenic
1194864543 X:99049539-99049561 TTGAAGCATGAGCAGGAGAAAGG + Intergenic
1195738009 X:108033424-108033446 TGGGTGCAGCAGCATGAGGAGGG - Intergenic
1195975386 X:110520963-110520985 TCGTAGCAGAAGCAGGAGCAAGG - Intergenic
1196791337 X:119468105-119468127 TTGGAGCAGGACCAGGACTAGGG - Intergenic
1196900033 X:120373895-120373917 GTGGAGCAGGAGGAGGAGGCGGG - Intronic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1197868708 X:131045685-131045707 TTCAAGCATCAGGAGGAGGAAGG + Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1198936299 X:141904703-141904725 CTGGAGCACCTGCAAGAGGAAGG - Exonic
1199088240 X:143657831-143657853 TAGGCGTAGCTGCAGGAGGATGG + Intergenic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200152540 X:153958350-153958372 TGGGAGCAGGAGGAGGAGGAAGG - Intronic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201972427 Y:19812208-19812230 TTGGAGTTGCAGTAGGAGAAGGG + Intergenic